Ты и твоя ДНК

 


В детстве я был толстым, и меня это радовало. Мои приоритеты были четко расставлены и располагались где-то между компьютерной игрой Age of Empires и пиццей. С тогдашней точки зрения, мои телеса были чем-то очень даже желательным. Я мог долго не замерзать, и когда у меня в рюкзаке был йогурт, я был рад, что меня нелегко свалить с ног. Но затем я будто очнулся от прекрасного сна. Наступил он: пубертатный период. А с ним и ужасные открытия вроде того, что, помимо компьютерных игр и мамочкиной баклажановой запеканки, точно заслуживающей какую-нибудь награду, есть и другие вещи, которые могли бы быть интересны. Мне стало ясно, что идеальное состояние – это нечто субъективное и изменчивое. Поэтому я стал питаться здоровой пищей, заниматься спортом, и через некоторое время от толстого Мартина остался только Мартин. Хорошо, что так вышло, потому что упитанные люди, которые пишут книги, рискуют получить насмешливое прозвище «шариковая ручка». Но если я дам волю своему аппетиту, возвращение толстого Мартина будет лишь вопросом времени.

Почему собственное тело побуждает нас к поведению, которое самому же телу и вредит? Может, эволюция ненадолго отвлеклась на уроке биологии и по ошибке подумала, что «выживает толстейший»? Или дело в том, что наше тело было оптимизировано для мира, в котором не существует ни белого шоколада, ни пиццы «Четыре сыра»? Эра, в которой мы не должны испытывать страх голода, только началась. И даже еще не во всем мире. Поэтому неудивительно, что наше тело, несмотря на существующее центральное отопление, пытается защитить нас от замерзания при помощи жирка, накопленного за зиму и, несмотря на круглосуточную службу доставки, готовится к подступающей голодной смерти. То, что наш организм не приспособлен к постоянно поступающим калориям, отражается в том, что в настоящее время больше людей страдают от избыточного веса, чем от недоедания.

Если позволить природе двигаться в своем темпе, биология человека будет адаптироваться к новым условиям окружающей среды в течение тысяч, если не миллионов лет.

А наша современная жизнь за несколько десятков лет может поменяться настолько радикально, что биология подумает: «А, да плевать» и даже пытаться не станет. Такое несоответствие между нашей средой, нашей психологией и биологией можно обойти тремя способами: мы изменяем либо среду, либо психологию, либо биологию.

С точки зрения нашего малоподвижного, богатого на замороженную пиццу образа жизни, это означает, что декадентским калорийным бомбам лучше быть недоступными (изменить окружающую среду) или что у нас должно хватать силы воли противостоять искушающим соблазнам (изменить психологию), с чем большинство людей вряд ли справляется. Третий, более радикальный, способ – изменить нашу биологическую основу самостоятельно. Так, чтобы тело человека могло лучше справляться с новыми условиями жизни.

Такова, например, идея «полипилла», таблетки с превентивным эффектом, которая сочетает в себе различные лекарственные компоненты для лучшего приспособления нашего организма к западному образу жизни и поддержания нормального уровня артериального давления и холестерина, несмотря на рацион с высоким содержанием жиров и малоподвижный образ жизни. Кроме того, такие вмешательства, как шунтирование желудка, при котором пищеварительная система уменьшается таким образом, чтобы вмещать меньшее количество еды, в конечном счете являются попытками радикально адаптировать биологию человека к среде, в которой чизбургеры стоят 1,29 евро и повсюду эскалаторы.

Но даже наш интеллект едва ли обладает способностью на биологическом уровне адаптироваться к становящейся все более сложной, технологически продвинутой среде, в которой мы живем сегодня. В результате препараты, способствующие концентрации, такие как риталин и другие виды «допинга для мозга», становятся все более популярными для адаптации нашего мыслительного органа к изменяющейся среде. Даже человеческую психику приспосабливают к условиям жизни, которые не соответствуют нашей природе – благодаря антидепрессантам.

 

Better Babies

Однако возможности таких вмешательств быстро достигают своих пределов, поскольку последующее ограничение ущерба включено в уже существующую биологическую основу. Биология хомяка не позволит ему решать интегральные уравнения, даже если вы скормите ему годовой запас риталина. Скорее, наоборот – он упадет замертво. Поэтому неудивительно, что люди очарованы идеей целенаправленного воздействия на эту основу. Правда, мы не были первыми, у кого возникла подобная идея. Природа опередила нас миллионы лет назад. В конце концов, одна из главных причин того, что одни люди для вас более привлекательны, чем другие, заключается в том, что вы хотите наделить своих детей наилучшими качествами из возможных. При этом люди выделяются на фоне других животных, поскольку некоторые из нас даже награждаются кубками, если считается, что они сделали хороший выбор партнера. В начале XX века на народных гуляньях в США проводились соревнования Better Babies – «Лучшие дети», на которых медики и медсестры оценивали младенцев с 6 месяцев. Лучшие из них могли набрать максимум 1000 баллов: 700 – за безупречную внешность, 200 – за умственную работоспособность и 100 – за физические характеристики, такие как рост и вес. Почему это 700 очков за внешность и только 200 за умственные способности? Ну а что вы ожидали от народных гуляний, на которых сравнивают только семена и скот? Родители победителей получали трофей, а проигравшие – список с советами о том, как сделать своего кроху лучшим. Цель соревнований состояла в том, чтобы мотивировать людей производить потомство, которое благожелательно воспримет большая часть общества. Все это делалось в надежде на то, что от этого выиграет вся страна. Не прошло и 30 лет со дня смерти Чарльза Дарвина, как люди попытались испортить его теорию. Однако без особого успеха. Вероятно, потому что перспектива получения кубка на народном празднике редко находится на вершине списка приоритетов при выборе партнера.

Какими бы немыслимыми ни казались эти соревнования современному человеку, их основная идея была не совсем абсурдной. С точки зрения генетики, отдельные свойства могут накапливаться при вступлении в брак в определенных группах.

Пример этого можно наблюдать у членов группы, принадлежащей к религиозной общине амишей. Они представляют особый интерес для науки, потому что все еще живут в уединении в Соединенных Штатах, вступают в брак только в пределах своего сообщества и, следовательно, образуют генетически ограниченную группу. В 2017 году исследователи обнаружили у амишей вариант гена, который не только замедлял старение организма своего носителя, но и дольше сохранял здоровье. У 16 % амишей, принявших участие в исследовании, была мутация в обеих копиях гена SERPINE1, что продлевало их жизнь в среднем на 10 лет по сравнению с их немутировавшими братьями и сестрами по вере, а еще они реже страдали от диабета и сердечно-сосудистых заболеваний.

Люди выделяются на фоне других животных, поскольку некоторые из нас даже награждаются призовыми кубками, если считается, что выбор партнера был удачным.

Итак, каков рецепт общественного источника молодости: найти ограниченную группу преимущественно мутировавших друзей и окунуться в безудержный групповой инцест с участием всех поколений? Нет, если группа настолько небольшая, что в ней слишком мало генетического разнообразия. Должно быть, Карл II, последний Габсбург в Испании, переживал бы эту новость болезненно. Он был физически больным, умственно отсталым и обладал лицом, которое могла любить только мама. Даже если бы у Карла не было импотенции, он, вероятно, все равно умер бы бездетным. Его неспособность зачать потомков не только беспокоила его, но и повергла половину Европы в хаос во время войны за испанское наследство. Совсем не триумфальный конец многовековой брачной политики, которая ставила политические интересы выше интересов генетического разнообразия.

Никто точно не знает, какое количество индивидов должно быть в обществе, чтобы оно вопреки исключительно внутригрупповому размножению обладало достаточным генетическим разнообразием для выживания в долгосрочной перспективе. Многие расчеты доходят до нескольких тысяч человек.

Но у вас не так много друзей, даже если аккаунт на Facebook говорит об обратном, поэтому и не пытайтесь.

 

От гена до человеческого качества

С сегодняшней точки зрения, время Карла II давно прошло, и с тех пор были разработаны многие вещи, которые однозначно могли бы улучшить его жизнь: личная гигиена, знакомства в интернете и современная генетика, а вместе с ней и предстоящее появление возможности вмешиваться в генетический материал человека. Необходимым условием для переписывания кода жизни, нашей ДНК, является возможность его прочтения.

Хоть это и нелегко, мы стали в этом довольно хороши. Книгу можно просто открывать и заглядывать в нее снова и снова. Но если вы повторите то же самое с человеком, вы окажетесь в тюрьме. Чтобы считать ДНК, нужно действовать мудрее, хотя на первый взгляд она кажется довольно незамысловатой. Наша генетическая информация записана всего лишь в 4 буквах, которые также называются основаниями: A (аденин), T (тимин), G (гуанин) и C (цитозин). Четыре буквы находятся на нитевидном костяке, состоящем из молекул сахара и фосфата.

Таким образом, ДНК человека формирует код длиной три миллиарда букв, который живет в форме так называемой двойной спирали, свернутой в ядрах клеток нашего тела. Если выцепить эту нить из одной ячейки, распутать ее и вытянуть в прямую линию, ее длина составит почти два метра. Эта молекула является результатом почти четырех миллиардов лет естественного отбора. Бесчисленные поколения, благодаря своей доблестной борьбе за выживание и неукротимой одержимости сексом, позволили постоянно совершенствующейся копии этой молекулы беспрерывно двигаться от первого живого существа в мире к вам. Все, что определяет человека до того момента, когда окружающая среда добавляется в качестве второго определяющего фактора, записывается в этой нити, которая слишком мала даже для того, чтобы можно было охарактеризовать ее словом «микроскопическая». Многие знают это, но очень немногие могут представить, как эта безжизненная, незаметная молекула способна влиять на такие личные качества человека, как эмпатия. Для наглядности, пожалуйста, прочитайте вслух следующий абзац:

Наша генетическая информация записана всего лишь в 4 буквах, а длина цепочки ДНК в ядре одной клетке – почти два метра.

GGGAGGGAGCCCTGTGGGGTTGCCTTTGCTTCCAAAAGTTGCCAGGGCAAGGTGGTAAGGTCAGCAGGTGGGCCAGTGCCTCAGGTCACACCCAGA

CACGCCAGCCCGGGGCCACAGACCTCACCCAGCCTCCACAGACAGTGTGATGCAGCCAGGGCACCTGCTAATCTCCTCCTGATCCGAGGCCCTCCAC

AACCCCTCTTCCCCTCCTCACCCCTCCCGAAACCCACACAGACAGCCATCAAATGGAAACATGATGTAGCAGGGCCTCACCCAAGAGGCTGGTTTGGG

GTTAGCTTTTGAGTTTTTTGATTTTGGATTTTTGTTTTTTAGCTGTTATTTATCAAACCTTTGGGGGGAAAAGAAGTGAAATCACCACAGGGCAGAAACC

CTAAGGGAAAACATTAACATTAGCTAAGAACATAAAAGAACACACAATTACTTAATCATATAAGTGTCTGAAGTTAACTGTCCATCTAATTGTGATTTGT

ACCCAGAAGGGCCGAGCTTGTGCACTCTTCATGGCCCAGAGTGAATATCCTGTCCAAGCTTCTCCTGCCGGCCCACCATGCTCTCCACATCACTGGGT

CACCTCAAGAAAAAGCCCCTCCAAGGGGCCTGGTCCCCCACACCTCGGGCACAGCATTCATGGAAAGGAAAGGTGTACGGGACATGCCCGAGGTCCT

CAGTCCCACAGAAACAGGGAGGGGCTGGGAAGCTCATTCTACAGATGGGGAAACAGTTCAAACCAGGCCTCCTGTGCCTGTCAGCCTTCCTCCCAGT

CCAACGCTCCTGACAGATGTTTGGTTGCCCCAGTGATGGGGCGCTCCTTTCTTTTCCAGGTTGCCAGTTCTGTTTRCAGACAGCTGCTTAGAAAGTCCC

TATTCCTCCTGAGTCCAGCTCTTCATGGCCATCCCTGCCCCGTCTCACTCACCTCTCTGCTCCCATTTTCCACGTATTTGGCAAGCACTGGTTGAGCTAT

CAATGACTGTGCAGCCTTGTGCCAGGCATCCCCTGGGGTAAAAGGCATCCCCTGGAGTTGTGCCACAAAACAGCCCACACATTGGACTTGGGCTTAAC

AAGTAGGGAACAGGACAAGCAGCGTCCCTGCTGTGATAGGGCTCATAGTCCACCTCTCCGGCCTTAACAAGCTTCTCTCCCACCTCCCAGCCTCCCCG

GACACATCACCTGCTGTCCACTCCCATTCCCTCCACCCAGGCTCAAGACAAGAATCCCCATCTTGTCCATCAGGAAGGGGCCATAGGTCACACCATTTA

ATCCTCACATCAACCCCAGGCAGTGAGCCGTGCTATCCTTATTACATGGAGGAGGAGGTGGAGGCTCAGAGCAGGTAAAGCAACTGGCTTAAGGACA

CTGG

Заметили что-то? Правильно, в середине салата из букв стоит буква R. Я выделил ее жирным шрифтом, потому что вы слишком хороши для того, чтобы сидеть и внимательно читать несколько строк. Этот абзац составляет около 7 % последовательности ДНК гена, называемого OXTR, который кодирует рецептор гормона окситоцина. Наличие этого рецептора – необходимое условие для того, чтобы клетки мозга реагировали на гормон, различными способами влияющий на наше социальное поведение. Буква R в середине последовательности в данном случае не означает, что мы получим Нобелевскую премию за открытие нового элемента ДНК. Он просто служит заполнителем, потому что на этом участке ДНК может находиться либо А, либо G. В зависимости от того, чью ДНК проверять. «Да боже мой, – подумали вы сейчас, – одна буква из трех миллиардов, на это даже радикальные граммар-наци смотрели бы сквозь пальцы».

Но в генетике малейшие изменения могут оказать большое влияние. Многие исследования показали, что эта единственная буква влияет на функцию рецептора окситоцина и, следовательно, также меняет наше социальное поведение – в зависимости от того, находится ли в этой точке G или A.

Люди, у которых в обеих копиях гена OXTR в этом месте стоит G, в среднем более эмпатичны, реже чувствуют себя одинокими и более деликатно взаимодействуют со своими детьми, по сравнению с людьми, у которых в обеих копиях находится А. И это только один пример из многих. В одном только гене OXTR известно огромное количество мутаций, влияющих на наше поведение. Наше мышление и действия основываются на множестве гормонов и нейромедиаторов, функции и скоординированность которых могут зависеть от крошечных изменений в ДНК.

Мы несем в себе две копии почти всех наших генов – одну от матери и одну от отца.

Делает ли последовательность ДНК из нас умственно отсталых?

Все это мы можем исследовать только потому, что удивительно преуспели в считывании нашей генетической информации.

Чтобы расшифровать последовательность ДНК первого человеческого генома, более 1000 ученых по всему миру работали над этим в течение 13 лет и растранжирили 3 миллиарда долларов.

Результат появился в 2003 году. Сегодня уверенно растет тенденция секвенирования полного человеческого генома – это происходит каждые 10 минут. Между тем уверенно снижается тенденция высокой стоимости процедуры: стоит она менее 1000 долларов за геном. Таким образом, считывание генома человека очень близко к тому, чтобы стать рутинной медицинской процедурой. По крайней мере, с технической точки зрения, это скоро перестанет быть проблемой. Правда, еще неизвестно, не станет ли это проблемой с точки зрения человеческой. Можно ли уже сейчас изменить человека, рассказав ему кое-что о его генах?

«Эксперты в области генетики человека рассказали нам, что небольшая численность популяции тутси связана с тем, что они женятся только друг на друге… Таракан не может произвести на свет бабочку. Таракан рождает другого таракана», – говорится в заметке газеты хуту «Кангура» от марта 1993 года. В следующем году за несколько месяцев представители хуту, которых было подавляющее большинство, убили сотни тысяч живших в Руанде людей, принадлежавших к меньшинству тутси. Задолго до того как был секвенирован первый человеческий геном, намек на генетические различия уже использовался для того, чтобы настроить группы населения друг против друга. Исследователи смогли доказать, что мы отдаем предпочтение людям, которые, по нашему мнению, генетически похожи на нас. Это нечестно, но иногда эволюция ведет себя, как бесчувственный эгоист. Поддерживать кого-то, кто генетически похож на тебя, – вторая лучшая стратегия распространения своего генетического материала после прямой его передачи.

Чем более схожи существа друг с другом, тем чаще между ними наблюдаются альтруистические отношения, поскольку это увеличивает шанс передачи своих генов последующим поколениям.

Между тем стало легко получить грубый генетический анализ, который сравнивает идентичность собственной ДНК с популяциями по всему миру. Провайдеру «23andMe» достаточно для этого небольшого количества слюны, шести недель и 99 евро. В условиях все большего распространения генетических анализов напрашивается вопрос, как люди относятся к их результатам. В исследовании 2016 года ученые проверили, какое влияние на людей оказывает обнаружение того факта, что их ДНК похожа или не похожа на другую группу. Чтобы сделать исследование более интригующим, они отобрали участников из двух групп населения, известных своей нелюбовью друг к другу, – евреев и арабов. Им давали газетные статьи, содержащие информацию либо о генетических различиях между этими группами населения, либо о генетических сходствах. Затем исследователи проверили, изменились ли предубеждения участников касательно другой группы в зависимости от того, какую статью они прочитали. Участники, проинформированные о генетических различиях, охарактеризовали другую группу как более жестокую и недружелюбную, хотя в газетной статье ни о чем подобном не упоминалось.

Задолго до того как был секвенирован первый человеческий геном, намек на генетические различия уже использовался для того, чтобы настроить разные социальные группы друг против друга.

Но меняет ли это их отношение? В другом эксперименте организаторы ввели в заблуждение участников еврейского происхождения: они должны были играть в компьютерную игру с человеком по имени Мухаммед, который якобы находится в другой комнате. В игре еврейские участники эксперимента после каждого выигранного раунда должны были наказывать проигравшего Мухаммеда шумом, интенсивность которого они выбирали сами – от приемлемо низкого до неприемлемо громкого. Если прежде испытуемые читали статью о генетических различиях, то выбирали более высокий уровень громкости по сравнению с теми, кто был проинформирован о генетическом сходстве. Однако ученые пошли еще дальше и продолжили исследования в Израиле, в месте, где конфликт между двумя национальностями наиболее выраженный. Евреи-израильтяне, читавшие о генетических различиях, были менее склонны идти на политические компромиссы с палестинцами и более склонны поддерживать их политическое исключение, а также выказывали четко выраженную готовность к коллективным наказаниям.

Какой вывод мы можем из этого сделать? Люди неустанно ищут причины дистанцироваться от неугодных социальных групп, как Гаргамель от смурфиков. Тем не менее исследование также показало, что подчеркивание генетического сходства в некоторых случаях привело к поддержке мирных настроений. Неясно, являются ли эти эффекты краткосрочными или оказывают длительное влияние на отношения конфликтующих групп. Даже если все ДНК-тесты в мире не смогут склонить Александра Ван дер Беллена к желанию обзавестись лысиной, берцами и курткой-бомбером, исследование говорит нам, что не следует опрометчиво судить о вещах, которые столь же существенны для человеческого самопонимания, как наша собственная ДНК. Если кто-то решит исследовать свое происхождение с генетической точки зрения, чтобы получить результат, говорящий о полном отсутствии совпадений с определенными группами населения, – это абсолютно нормально. При этом следует помнить, что эти сравнения основаны на менее чем 0,1 % нашей ДНК, которая у каждого человека индивидуальна. Вы все правильно поняли: Дональд Трамп, Рихард Люгнер и вы делите более чем 99,9 % генетической информации. Носите с гордостью свои 0,1 %! Кроме того, нельзя делать однозначные выводы об отдельных людях только потому, что определенная черта в одной группе проявляется иначе, чем в другой. Это было бы статистическим невежеством, которое, к сожалению, часто перетекает в расизм и сексизм. Тот факт, что женщины в среднем меньше мужчин, не наводит вас на мысль о специфичном росте человека, с которым вы собираетесь отправиться на свидание вслепую. Так же и тот факт, что упомянутая ранее версия рецептора окситоцина с буквой G особенно широко распространена в Европе, ничего не говорит о чувствительности продавца ваших шницелей. Наконец, обладая этими знаниями, мы можем решить заняться одной из самых каверзных и одновременно актуальных тем генетики.

 

Изменение человеческого генома

Смотрите, я вообще не хочу убеждать вас, что мы должны генетически изменять людей. Моя задача состоит в том, чтобы показать вам, насколько мы далеки от возможности сделать это. Об этом пока не может быть и речи. Мы разберемся с тем, что в настоящее время возможно, а что нет и что будет возможно в ближайшее время. Говоря о генетическом изменении человека, нужно разделять две вещи, принципиально отличающиеся друг от друга: изменение взрослого человека и изменение крошечного сгустка клеток, из которого однажды разовьется человек.

В отличие от изменений взрослых людей, у генетиков гораздо больше возможностей для творчества при изменении эмбрионов, потому что многие из свойств, которые уже закрепились у взрослого человека во время развития, у эмбрионов все еще достаточно «гибкие» для внесения корректировок.

При условии, конечно, что эти свойства имеют значительную генетическую основу. Но на какие свойства это распространяется? И сколько вообще свойств у человека? При случае пригласите своего соседа на кофе и посмотрите, сколько его качеств вы можете описать. Растут ли волосы из ушей? А на пальцах ног? Он один из тех людей, что чихают, когда смотрят на яркий свет? Насколько чувствительной будет реакция на тепловое воздействие, если вы прольете кофе ему на промежность? Чем тщательнее вы осматриваете человека, тем больше его качеств вы можете описать. Их общее количество нельзя уложить ни в одну цифру, потому что оно зависит от того, насколько старательно вы ищете.

 

Что наследуется, а что – нет

Если вы хотите узнать, какие из наблюдаемых черт в большей степени обусловлены генетикой, лучший способ выяснить это – спросить у человека, к которому постоянно обращаетесь за советом, – у мамочки. Женщины лучше мужчин способны оценивать, какие свойства имеют прочную генетическую основу. При этом родители с двумя или более детьми показывают лучшие результаты в своей оценке. Предположительно потому, что они буквально собственными глазами видят, на какие качества могут значительно повлиять в ходе воспитания, а на какие – нет. Возможно, вы не потерпели неудачу как родитель, и ваш паршивец постоянно пытается пописать на кошку только лишь потому, что в генной рулетке вам не повезло с любовью к животным.

Научный подход, конечно, выглядит иначе, и даже самые внимательные, полностью посвящающие себя детям родители не слишком точны. Например, генетическое влияние на сексуальную ориентацию мирян, как правило, переоценивается, в то время как избыточный вес подвержен генетическому влиянию зачастую больше, чем предполагается. Поэтому самые точные сведения о наследственности человеческих свойств вы получаете от генетиков, которые интенсивно занимаются генетической основой человеческих характеристик около 50 лет. Наиболее полный обзор этой темы на сегодняшний день был опубликован в 2015 году, он обобщает результаты около 3000 научных исследований, посвященных наследованию более 17 000 характеристик человека. Как следует из этого обзора, ни одна из изученных черт не избежала генетического влияния. Пожалуйста, позвольте этому факту работать на вас.

Самая обширная из всех работ по вопросам наследования человеческих качеств дает вывод, что ни одно из них не является независимым от генетических факторов. Однако то, насколько ярко выражено это влияние, сильно зависит от самого рассматриваемого качества. В целом, исследователи пришли к выводу, что около половины всех поддающихся измерению различий между людьми обусловлены генами, а не воздействием окружающей среды.

 

Ни одно человеческое качество не является свободным от влияния генетики. Эволюция – оппортунистическая дуреха

Почему же человек в своем безграничном высокомерии воображает, что может организовать свой геном лучше, чем 4 миллиарда лет эволюционного процесса? Движущими силами эволюции являются мутации, то есть случайные изменения в ДНК в сочетании с естественным отбором. Как и любой термин, включающий слово «естественный», «естественный отбор» звучит относительно безобидно, почти приятно. Если бы вместо этого говорили «массовое подыхание плохо приспособленных», смысл бы не поменялся, но на уроках биологии было бы менее комфортно. С каждым новым поколением природа случайным образом смешивает родительские гены и вносит то одну, то другую спонтанную мутацию. Хорошо ли работают вместе смешанные варианты генов, которые встречаются друг с другом в никогда прежде не существовавшей комбинации, совершенно неизвестно. Кроме того, большинство спонтанно возникающих мутаций неблагоприятны. Этот процесс не имеет абсолютно ничего общего с «разумным замыслом» – он действует так же целеустремленно, как слепой пациент с болезнью Паркинсона, играющий в дартс.

В отличие от большинства млекопитающих, организм человека не может самостоятельно производить витамин С.

Если бы в процессе мутации и случайного перемешивания сохранялся родительский геном, в течение нескольких поколений он шел бы под откос практически со всеми свойствами. «Разумный» аспект эволюции, осуществляющий уборку, потому и является естественным отбором. Он на длительное время устраняет неблагоприятные варианты генов из генофонда. Ну, вы знаете, при помощи «массового подыхания плохо приспособленных». Однако у этой функции есть ограничения.

Причиной этого является генетическая мутация, которая, вероятно, не дает никаких преимуществ, но в прошлом приводила к бесчисленным смертям из-за дефицита витамина С. Если человек является подобием Бога, надеюсь, Всевышний исправно пьет на завтрак апельсиновый сок. Но очевидно, чтобы эта мутация исчезла из нашего генофонда, потребовалась бы большая гора трупов. И какая же все-таки функция у мужских сосков? Если на радио работает только каждая вторая кнопка, беру свои слова обратно! Абсурд, который тело осознает только после 25 лет, постыдно пытаясь скрыть бесполезные соски за пучком волос. Мы называем себя венцом творения, живя при этом в одном мире со свиньями, оргазм которых длится 20 минут.

Улучшится ли какое-либо свойство в результате эволюционного процесса, в конечном счете зависит от того, достаточное ли количество людей, обладающих неблагоприятным вариантом гена, умрут или, по крайней мере, будут размножаться менее успешно. У нас хорошая иммунная система, потому что в прошлом умерло достаточно людей, у которых она была плохая. Результат желательный, но естественный способ достичь его намного более жесток, чем если бы мы могли целенаправленно улучшать иммунную систему человека.

Эволюция стремится не к идеалу, а просто к «достаточно хорошо приспособленному человечеству, которое приведет в мир множество детей, которые, в свою очередь, также приведут в мир множество детей». Эволюция не испытывает непреодолимого интереса к благополучию индивидов, не следует никакому этическому кодексу – она безрассудно вознаграждает всех живых существ сохранением их генетического материала, если они производят на свет больше потомства, чем конкуренты. Это одна из причин, почему здоровье человека так быстро угасает, как только он выходит из репродуктивного возраста.

Эволюция вряд ли предпочитает варианты генов, которые приносят пользу в старости. На более поздних этапах жизни, когда мы едва активны в сексуальном плане или даже бесплодны, механизмы эволюции больше не работают. Даже если бы бабушка внезапно избавилась от своего ревматизма и ее суставы стали бы пригодными для прыжков с шестом, на передачу ее генов это никак не повлияет. Потому для механизмов эволюции признаки старения – будь то атрофия мышц или нейродегенеративные заболевания – малозначимы. Таким образом, возрастные изменения являются одной из областей, в которых целенаправленные генетические модификации человеческого организма могут однажды заполнить пробелы в процессе эволюционной оптимизации.

У нас хорошая иммунная система, потому что в прошлом умерло достаточно людей, у которых она была плохая.

Термин «венец творения» вводит нас в заблуждение, будто мы находимся на самой верхушке, в конце этого блестящего процесса. Это вдвойне ложь. Во-первых, потому, что мы не в конце, а в середине. Во-вторых, потому что генетические изменения, происходящие в природе, являются не совершенством, а нецеленаправленным совпадением.

Каждый человек появляется на свет со случайно возникшими мутациями, большинство из которых – нейтральные, некоторые – проблемные, и лишь очень немногие хоть как-то полезны.

Для того чтобы генетическое изменение, преднамеренно введенное людьми, имело больше смысла, чем естественное, оно не должно быть идеально спланировано. Достаточно, если у него будут выше шансы на положительный эффект, чем у чисто случайных, которые, как правило, отрицательно сказываются на генетике.

 

Генетическое изменение взрослых

Взрослые имеют преимущество в том, что, в отличие от недавно оплодотворенной яйцеклетки, способны ответить, хотят ли они, чтобы их генетически изменили. Недостатком, однако, является то, что взрослые состоят из чертова множества клеток.

Тело взрослого человека состоит из более чем 30 триллионов клеток. Как представить себе такое число? Если вы напечатаете и сложите 30 триллионов страниц бумаги, эта кипа сможет примерно восемь раз достать от Земли до Луны.

Четыре раза, если вы будете печатать на обеих сторонах бумаги. За некоторыми исключениями, каждая ваша клетка содержит весь план строения человеческого тела, записанный на смотанной нити ДНК длиной 1,8 метра. Но эта генетическая информация не свободно плавает по клеткам, а лежит, хорошо упакованная, в клеточных ядрах. Чтобы изменить генетическую информацию взрослого человека во всем теле, нужно найти способ надежно и безопасно встроить генетическую последовательность в триллионы клеточных ядер его организма. Думаю, вы представляете, насколько это непросто. Наше тело не слишком заинтересовано в том, чтобы возиться с каждой «приблудной» единицей ДНК, попадающей в ядра его клеток. Напротив, клетки стремятся максимально защитить свою ДНК от внешних воздействий, включая чужеродную генетическую информацию, которая пытается проникнуть туда. Каково это, когда чужеродной генетической информации все же удается попасть в ваши клетки, вы уже наверняка знаете благодаря простуде, ветряной оспе или герпесу.

Вы все правильно поняли: мы говорим о вирусах, мастерах в передаче генетической информации. Проще говоря, вирус состоит в основном из генетической информации, окруженной защитной оболочкой. Эта оболочка сильно различается у разных видов вирусов, и ее задача, помимо защиты, состоит в том, чтобы вирус мог легко привязаться к клетке и послать в нее свою генетическую информацию. Причем поведение некоторых вирусов похоже на поведение толстяка, который переливает колу с сахаром в бутылку с надписью Cola Light, чтобы незаметно прошмыгнуть с ней на ежемесячную встречу Weight Watchers: оболочка, вводя клетку в заблуждение, представляется совершенно не вызывающим опасений средством транспортировки питательных веществ, которое можно спокойно пропустить внутрь. Виртуозные молекулярные биологи используют эту способность вирусов переносить генетическую информацию в клетки и применяют их в качестве средства транспортировки желаемой ДНК в живые организмы. Для этого они упаковывают последовательность генов, которую хотят перенести, в вирусную оболочку, и клетки с радостью принимают генетическую информацию. При этом обычная вирусная генетическая информация, которая может стать причиной заболевания, полностью или, по крайней мере, в значительной степени устраняется. Так возникают вирусы, предназначенные для передачи желаемой ДНК и не вызывающие заболеваний, которыми они на самом деле известны.

Было бы глупо, если бы после каждого генетического апгрейда приходилось бороться с простудой, СПИДом или герпесом. Теперь с помощью искусно модифицированных вирусов возможность целенаправленно вводить генетическую информацию в клетки взрослых людей стала вполне реальной.

Заканчивается ли эра, в которой вирусы так же популярны, как собачий помет в центре Вены? Могу ли я наконец заразиться геном четырехрукости, чтобы дать себе двойную пять? К сожалению, с вирусами все не так просто. Некоторые из них, вообще-то отлично подходящие в качестве средств транспортировки генов, все равно будут вызывать панику у нашей иммунной системы, даже если в них нет патогенной генетической информации. Иммунная защита человека не дает кредит доверия ни одному новоприбывшему вирусу в надежде, что они сделают для нас что-то полезное. Если иммунная система обнаружит поверхность вируса, который связан с появлением болезни, он будет атакован, даже если имеет только добрые намерения. Возникающее в результате воспаление не только болезненно, но и делает передачу желаемой генетической информации крайне неэффективной. К счастью, не у всех вирусов есть эта проблема. Так называемые аденоассоциированные вирусы (ААВ), например, часто игнорируются нашей иммунной системой. Поэтому ААВ особенно популярны для введения генов во взрослые организмы, даже несмотря на то что они настолько крошечные, что в них может поместиться лишь небольшое количество ДНК и передастся только маленькая частичка генетической информации. Однако одно из самых больших препятствий на пути передачи генетической информации всему организму человека, а не отдельным его клеткам, заключается в том, что каждый вирус может атаковать только определенные виды клеток. Человеческое тело состоит из более чем 200 типов клеток. Ни один вирус в мире неспособен заразить каждый из них, и пока не предвидится появление метода, решившего бы эту проблему. Таким образом, полностью изменить геном взрослого человека не представляется возможным. И даже если бы такая возможность появилась, многие из черт, на которые удалось бы повлиять, у взрослых не изменились бы даже после внесения соответствующих вариантов генов. Причина в том, что многие гены активны не постоянно, а только на определенных этапах развития.

Если заменить ДНК вируса на что-нибудь более полезное, можно добавить эту мутацию человеку.

В конце пубертатного периода рост тела заканчивается, и кости навсегда утрачивают способность удлиняться. На это нельзя повлиять задним числом с помощью каких-нибудь генных уловок.

Даже если в 35 лет вы поймете, что карьера профессионального баскетболиста была бы более прибыльной, чем карьера администратора солярия в великой песчаной пустыне Бильмы.

Итак, вы родились слишком рано, чтобы извлечь выгоду из генетической модификации человека? Не сказал бы. Вообще, не похоже, что станет возможно надежно вводить генетическую последовательность во все клетки организма в ближайшем будущем, но это не так уж необходимо для изменения некоторых черт.

 

Дилемма Гольдмана

Вы бы согласились принять вещество, которое подарит вам золотую медаль на Олимпийских играх, но убьет вас в течение пяти лет? Если ваш ответ «да», то либо у вас невыносимая жизнь, либо вы высококлассный профессиональный спортсмен. Американский врач Боб Гольдман во многих исследованиях показал, что около половины всех спортсменов такого уровня были бы готовы потерять свою жизнь за пять лет, если им на Олимпиаде будет гарантирована золотая медаль. А вот от остального населения только около 1 % людей оказались готовы заплатить эту цену за выдающийся карьерный успех. Но даже это означает, что в одной лишь Австрии таких людей были бы десятки тысяч. При этом среднестатистический житель Вены в любом случае ответил бы: «Я дам тебе 1000 шиллингов, если ты убьешь меня прямо сейчас».

Готовность примириться со скорой смертью в обмен на колоссальный успех называется дилеммой Гольдмана. Подобное особенно хорошо прослеживается в психологии спорта и часто упоминается в связи с генным допингом.

Дилемма Гольдмана показывает, что генетические изменения для повышения эффективности не всегда бывают абсолютно безопасными, но при этом есть множество людей, которые мирятся с риском.

И уже есть люди, пытающиеся получить такие генетические обновления. На компьютере Томаса Спрингштейна, выбранного тренером года по легкой атлетике в Германии в 2002 году, обнаружили письма, из которых он узнавал, где можно достать генное допинговое средство репоксиген.

Речь идет о проверенном на мышах вирусе, способного вводить ген, называемый ЭПО, в клетки мышц. Оказавшись там, он производит эритропоэтин, что приводит к увеличению количества эритроцитов, улучшая общее насыщение организма кислородом. Вирус был разработан для лечения анемии. Однако у спортсменов вирус может увеличить выносливость. Чтобы генетическое изменение повлияло на весь организм, инфицирование каждой клетки не является неизбежным условием. В некоторых случаях также достаточно, чтобы пораженные клетки выделяли что-либо в кровь.

Глибера, которая была утверждена в Европе в 2012 году как первая генная терапия, также была основана на этом принципе. Препарат борется с генетически обусловленной болезнью обмена веществ, делающей кровь кремообразной и густой, что является опасным для жизни. Глибера использует вирусы для введения исправленного гена в мышцы ног человека. Для этого в оба бедра делаются десятки инъекций, и иммунную систему пациента временно подавляют, чтобы она не начала ликвидировать вирусы, прежде чем они выполнят свою работу. По окончании процедуры мышцы образуют протеин, который отправляется в кровь, после чего состояние пациента значительно улучшается. Это большая радость для больных, но ее, впрочем, несколько омрачает то обстоятельство, что одна процедура стоит около миллиона евро. Бесплатные предписания врача – слабое утешение.

Глибера стала самым дорогим лекарством в мире, и первая пациентка, готовая за него заплатить, нашлась только в 2016 году. Первая – и последняя.

Поскольку едва ли кто-то мог себе это позволить, глиберу тем временем снова сняли с рынка. Остается, по крайней мере, уверенность в том, что теперь мы можем безопасно вводить в мышцы генные последовательности, транспортирующие желаемые протеины в кровь.

 

Создание интеллекта для тупиц

Является ли генный допинг феноменом далекого будущего или частью современного мира, по крайней мере спортсменов, никто не может сказать с уверенностью. Зачастую регулярные допинг-тесты не позволяют подтвердить наличие генетических изменений для повышения результативности спортсмена. На дне различных интернет-форумов атлеты-любители бредят толстыми мышцами, ради которых не была бы пролита ни одна капля пота. При этом они часто ссылаются на эксперимент, проведенный в 2009 году, когда исследователи поместили ген фоллистатина в вирус и ввели его в переднюю мышцу бедра макак. Фоллистатин способствует росту мышц, нейтрализуя тормозящий рост мышц белок миостатин. Следовательно, увеличение количества фоллистатина в мышечных клетках приводит к усилению мышечного роста, даже если вы идете в фитнес-студию только для того, чтобы полюбоваться собой в настенных зеркалах или просидеть все время на диване, лопая картофельные чипсы. Только, пожалуйста, не думайте, что вы можете заразиться мышечными вирусами, отираясь около самого надутого здоровяка в качалке. Используемый вирус не может быть передан напрямую. Единственное, чего вы добьетесь – это неприятная атмосфера в сауне после. При этом используются вирусы, которые зачастую не вызывают значительной реакции иммунной системы. Существует возможность введения генетической информации в клетки живого существа таким образом, чтобы не встраивать ДНК в геном длительное время и на случайном участке. Вместо этого введенная последовательность гена остается отдельной частичкой генетической информации в ядре клетки, и это самый безопасный из всех вариантов. Таким образом, ген фоллистатина может пробыть в клетках много лет и сделать мышцы толще. У макак вирус с фоллистатином также приводил к длительному росту мышц бедра и незаурядному увеличению силы. Спустя всего 8 недель без каких-либо тренировок их бедра были уже на 15 % больше, чем у макак из контрольной группы. Негативных последствий для здоровья ученые при этом не обнаружили.

Кровь не является благоприятной средой для вирусов.

Некоторые мышцы более популярны, чем другие. Например, едва ли кто-то заинтересован в целенаправленной тренировке Musculus cremaster, хотя перед ней стоит важная задача: подтянуть яички в случае необходимости. Обратная ситуация с бицепсом, который настолько широко признан, что его часто называют «грудью мужика» или даже «воротами в душу качка». Но очень немногие люди выигрывают от раздувания отдельных мышц. Исключением, как это часто бывает, является страстный дископампер. И кто хочет себе инъекцию в каждую из более чем 600 мышц? Было бы практичнее не вводить вирусы напрямую в отдельные мышцы, а вводить их в кровоток, откуда они смогут влиять на все мышцы тела. Эта идея провалилась еще несколько лет назад, потому что выяснилось, что кровь не является благоприятной для вирусов средой, и частицы вируса не попали в нужные клетки. Однако в 2015 году американской группе ученых впервые удалось внедрить вирусы в кровеносные сосуды крупных млекопитающих, которые затем эффективно распространили гены по мышечной ткани всего организма. Они ввели триллионы специально измененных вирусов в кровеносные сосуды трех молодых собак, страдающих от истощения мышц. Вирусы содержали исправленную форму последовательности генов, которая была дефектной у испытуемых. Как только вирусы были введены, они фактически начали инфицировать всю мышечную систему животных и переносить ген без проявления значительных побочных эффектов. Так исследователи заложили основу для переноса генов в мышцы человека по всему телу, потому что на биологическом уровне собаки и люди удивительно похожи. Даже если очень немногие из нас едят свои фекалии и, по крайней мере, в трезвом состоянии редко ловят собственный хвост.

В настоящее время очень легко переносить ДНК в клетки человека с помощью вирусов. Сложность в том, чтобы эффективно и безопасно ввести эти вирусы в нужные клетки, не нанося вреда геному в целом.

Аденоассоциированные вирусы (ААВ) считаются для этого наиболее безопасными, и мышечные клетки являются отличными мишенями для перенесения генов, поскольку их легко инфицировать и они не смогут больше делиться. Кроме того, мышечные клетки настолько хорошо снабжаются кровью, что к ним легко могут попасть вирусы, которые вводятся в кровоток. По-видимому, генетическое изменение у взрослых сперва затрагивает мышцы или для их непосредственного изменения, или для того, чтобы мышечные клетки доставляли нужные вещества в кровь. Но и другие клетки можно затронуть, изменив оболочки ААВ либо выбрав совершенно другой вирус, учитывая, что у каждого из них свои преимущества и недостатки. Чтобы сделать вирусы более эффективными и безопасными средствами транспортировки ведутся интенсивные работы по их развитию либо путем целенаправленного изменения оболочки, либо с помощью процесса под названием «направленная эволюция», который я предпочитаю называть «создание интеллекта для тупиц», поскольку он позволяет улучшить конкретное свойство без необходимости знания того, какие гены должны быть изменены. В этом процессе поэтапно проводятся случайные генетические изменения вирусов, и вирусы, свойства которых изменились в желаемом направлении, неизменно подвергаются дальнейшему использованию. Эти чуть улучшенные вирусы применяются в следующем раунде случайных изменений и так далее. В конце направленной эволюции находятся оптимизированные вирусы, свойства которых гораздо более выгодны для нас, нежели их исходных вариантов. Между тем, существуют ААВ, которые могут вносить свою генетическую информацию точечно, скажем, в печень, сердечную мышцу или нервную систему.

На биологическом уровне собаки и люди удивительно похожи.

Вирусы, разрабатываемые в настоящее время, используются для лечения ранее неизлечимых заболеваний. Это не встречает большого сопротивления, потому что никто не хочет говорить больному, что он должен смириться со своим состоянием. Но как насчет здоровых людей, которые хотят проапгрейдить свою биологическую основу? Как только вирус подтвердился в качестве надежного средства транспортировки, стало относительно легко заменить переносимую им последовательность генов на другую. Точно так же, как сложно было изобрести берлинский пончик, но наполнить его ванильным пудингом вместо джема – проще простого.

Какой из вирусов в меню оптимизации вы бы выбрали? Как насчет гена фоллистатина FST, который подарит сексуальное тело мечты, несмотря на ваш кошмарный образ жизни? Или вы хотели бы улучшить выносливость и не проклинать вселенную, как только вам приходится пробежать 15 секунд до вокзала? Тогда вас может заинтересовать повышающий выносливость ген эритропоэтина EPO, а также ген альфа-актинина 3 ACTN3, который улучшает результаты в спринте. Вы часто попадаете в потасовки, потому что всегда героически вмешиваетесь, если видите несправедливость? Или вы просто невыносимый кретин, который действует всем на нервы? Тогда я рекомендую плотные, неразрушимые кости, получаемые благодаря версии гена LRP5. Конечно, такие вирусы не купить в супермаркете. И, по-видимому, побочные эффекты будут настолько серьезными, что они затмят желаемые результаты. Но вы же знаете, люди – они такие, просто нужно сказать одному: «Никогда так не рискуй», и они сразу это сделают.

 

Генный допинг своими руками

Производство таких последовательностей генов для самооптимизации стало настолько простым делом, что нигилистических смельчаков вряд ли можно удержать от экспериментов на собственных организмах. Или от зарабатывания на этом денег. Генетическую последовательность, которая сулит неограниченный рост мышц посредством инактивации гена миостатина, можно раздобыть в Интернете по цене от 20 долларов.

Мы живем в то время, когда за одни и те же деньги вы можете позволить себе и заказать генный допинг в Интернете, и побаловать себя большой пиццей с салатом и колой.

Американский биохакер Джозайя Зайнер решил отказаться от пиццы и стал первым, кто попытался целенаправленно изменить свой собственный геном. Биохакерами называют не тех, кто перекапывает свой огород с помощью хака, а людей, которые пытаются проапгрейдить собственную биологическую основу. В 2017 году на одной конференции Зайнер ввел себе в левое предплечье последовательность ДНК, стимулирующую рост мышц. За этим последовали аплодисменты, и Зайнер с облегчением смочил глотку стаканчиком шнапса. То, что его действия принесли много чего, помимо шумихи в СМИ, маловероятно. Он даже не потрудился упаковать ДНК перед инъекцией в вирус, как сделал бы приличный биолог. В результате внедрение в мышцы было настолько неэффективно, что возникает вопрос, изменилась ли хотя бы одна клетка его организма. Тем не менее это мероприятие вселило отвагу в других биохакеров в их гаражах-лабораториях.

Однако я не верю, что из любительских махинаций с собственным геномом может получиться что-то толковое. Наша генетическая информация сложна. Стремление оптимизировать ее без надлежащей подготовки так же дерзко, как и утверждение, что можно улучшить вертолет, не попробовав предварительно ввинтить пару болтов хотя бы в велосипед. В случае с биохакерами успокаивает то, что их эксперименты заканчиваются на них же и что, возможно, успешные генетические изменения не будут переданы их детям. Для этого должны быть изменены именно предшественники сперматозоидов или яйцеклеток, которые называются клетками зародышевого пути. Все остальные клетки организма, генетический материал которых не передается потомкам, называются соматическими. Сюда относятся мышцы, нервная ткань и все остальное, что не образует половые клетки. Пока что вам не нужно беспокоиться о человеческом генофонде. Конечно, если не всплывут видео от биохакеров, которые делают себе инъекции в яички. Но кто уж станет делать это добровольно – особенно в чате перед включенной камерой. Однако, если кто-то сознательно захочет вмешаться в ДНК своих потомков и основательно изменить генетику последующих поколений, он может избежать обходного пути в виде инъекции в яички и приняться непосредственно за следующее поколение. Правда, в то время, когда различие между клетками зародышевого пути и соматическими клетками не будет иметь значения, потому что они совсем не будут отличаться друг от друга. Речь идет об изменении микроскопически маленьких эмбрионов.

 

Генетическое изменение эмбрионов

В следующий раз, когда вы встретите беременную женщину, суньте ей в руки пачку «Мальборо», бутылку водки и Контегран и скажите: «Не дрейфь». Этот элегантный эксперимент демонстрирует два феномена одновременно.

Во-первых, когда вытянутая ладонь под правильным углом наносит удар по слуховому органу, пощечина удивительно болезненна.

Во-вторых, родители готовы сделать все от них зависящее, чтобы наделить своих потомков качествами, которые обещают детям наилучшую жизнь.

Поэтому высокомотивированные будущие матери наполняют жизнь крохи музыкой Моцарта, когда он еще находится в утробе, хотя лучшие эмбрионы все равно предпочитают слушать Slipknot. Всего через несколько недель после рождения малышам делают различные прививки, чтобы повысить их шансы на здоровую жизнь. А если средства позволяют, вы можете пойти на дорогие учебные курсы, чтобы дать детям интеллектуальное преимущество.

Родители, использующие все возможности для снабжения своего ребенка лучшей комбинацией карт для жизни, выглядят образцовыми. При условии, что гены не подвергаются изменению! В противном случае всплывает словосочетание «спроектированный ребенок», которого люди с факелами и вилами выгоняют из города и блокируют в Твиттере.

Любая традиционная попытка наделить своего ребенка максимально высоким интеллектом, наилучшим здоровьем и высокой степенью сочувствия считается желательной. И хотя сегодня мы знаем, что в основе этих свойств лежит ярко выраженный генетический компонент, целенаправленное генетическое влияние на них – табу. Вероятно, одной из причин этого является то, что фильмы типа «Гаттаки», в которых герой борется с ужасным обществом, обезображенным генной инженерией, продаются лучше, чем фильмы, в которых благодаря генетической оптимизации больше людей наслаждаются крепким здоровьем и при этом являются чрезвычайно разумными и чуткими людьми.

Если все же хочется генетически модифицировать эмбрион, для этого достаточно свободы действий. Удобно, что на ранних стадиях эмбрионы совсем крошечные и состоят всего лишь из пригоршни клеток. Надежное и точное изменение генетического материала этого хорошенького комочка клеток представляется гораздо более реалистичным, чем изменение многих триллионов клеток взрослого человека. Кроме того, в недавно оплодотворенной яйцеклетке еще не сформировалась иммунная система, которая могла бы оказывать сопротивление генетическим изменениям. Таким образом, эмбрионы буквально напрашиваются на генетические изменения, в связи с чем уже в течение многих лет успешно осуществляются вмешательства в геном экспериментальных животных путем изменения их эмбриональных клеток.

В недавно оплодотворенной яйцеклетке еще нет иммунной системы.

Первое генетическое изменение животного, основанное на методах генной инженерии, произошло в 1974 году. При этом ДНК вводилась с помощью вируса в эмбрион мыши на ранней стадии развития. То есть уже 45 лет мы способны вмешиваться в генетический материал млекопитающих. Почему ученые совсем недавно так интенсивно стали говорить о возможности изменения ДНК эмбрионов человека? Вероятно, потому, что именно этим они начали заниматься несколько лет назад.

 

CRISPR CRISPR ХРУСТЬ

Эффективное изменение эмбрионов стало возможным благодаря разработке мощного и точного инструмента. Он работает так точно и настолько легок в использовании, что в 2015 году генетики впервые решились на генетическое изменение человеческих эмбрионов. С тех пор все больше исследовательских групп запрыгивает в этот поезд. Возможно, вы уже слышали об этом, а если нет, то однозначно услышите в ближайшее время: генетические ножницы CRISPR / Cas9. Желая получить знания (а вы, я знаю, желаете), вы сразу задатите несколько вопросов: «Что такое генетические ножницы? Можно ли упаковать их в ручную кладь в аэропорту? Разрешено ли спроектированным детям бегать с генетическими ножницами в руках?» CRISPR / Cas9 (произносится Крисп-Kас-девять) – это сокращение от Clustered Regularly Interspaced Short Palindromic Repeats / CRISPR Associated 9, что в переводе на русский означает «короткие палиндромные повторы, регулярно расположенные группами». Вам не нужно это запоминать, но, по крайней мере, теперь вы можете утверждать, что где-то уже об этом читали.

CRISPR – это последнее поколение генетических ножниц, позволяющих нам осуществлять целенаправленные изменения в ДНК материале с беспрецедентной легкостью и точностью. Технология CRISPR продолжает развиваться так быстро, что любая исследовательская работа, которая ведется в настоящее время, в основном работает уже со старым инструментом. Можно сравнить со смартфонами: вам не хочется покупать текущую модель, потому что через две недели все равно появится новая. Только покупка современного айфона обойдется дороже, чем комплектующий набор CRISPR.

Чтобы целенаправленно изменять ДНК, CRISPR использует два компонента: один определяет, в каком месте ДНК должна быть изменена (гРНК), а другой на этом месте вносит изменения (Cas9). ГРНК (гидовая РНК) – это своего рода закладка, которая может быть положена только в определенной точке генома. Сама она состоит из короткой нити генетической информации и содержит последовательность длиной в 20 букв, которую можно выбрать самостоятельно и тем самым определить, к какому месту в геноме она подходит. Сама гРНК может не более чем связываться с ДНК, поэтому ей необходим второй компонент для изменения ДНК в определенном месте: энзим Cas9. Cas9 присоединяется к гРНК, та направляет его к участку генома, который должен быть изменен. Оказавшись на месте, Cas9 прорезает нить ДНК, что объясняет происхождение термина «генетические ножницы». Выбирая подходящую гРНК, можно точно указать при помощи буквы, где именно в геноме Cas9 должен сделать разрез. Так работает оригинальная стандартная версия CRISPR, которая может исключить ген. Однако CRISPR также может быть использован для добавления новых последовательностей генов путем введения их в клетку в дополнение к гРНК и Cas9. Более новые версии системы CRISPR позволяют даже временно включать или выключать гены или изменять отдельные буквы ДНК без необходимости прорезания двухцепочной ДНК. Можно сказать, что CRISPR – это не просто инструмент, а набор инструментов, превративший сложную задачу по модификации генов в простую для освоения игру в кубики. До появления CRISPR, как правило, было необходимо сконструировать собственный белок для целенаправленной генной модификации. Это было чрезвычайно затратно и в некоторых случаях занимало годы. С CRISPR это можно сделать в течение нескольких недель.

Покупка современного айфона обойдется дороже, чем комплектующий набор CRISPR.

Все, что необходимо для создания вируса CRISPR, подробно описано в протоколах. Следовать им так же легко, как рецептам в кулинарной книге, за исключением того, что измеряется все микрограммами, и редко можно встретить такие величины, как «щепотка» или «по вкусу». Единственное, что не описано в этих стандартизированных инструкциях, это 20-буквенная последовательность гРНК, поскольку она зависит от того, какой ген вы хотите изменить. К счастью, вы можете легко и просто сделать это самостоятельно.

После того как я так долго мучил вас теорией, пришло время для небольшой практики. Встаньте, немного потянитесь и – шагом марш к своему компьютеру: сейчас мы будем создавать последовательность CRISPR.  Я знаю, юмор очень важен в науке. В поле «Target» введите название вашего любимого гена, например, «MSTN», ген миостатина, который обеспечивает безудержный рост мышц при потере функциональности. Затем нажмите «Find Target Sites!» Отлично, в разделе «Target sequence» вы увидите несколько возможных последовательностей для вашей гРНК, отсортированных по их эффективности и точности. Более того, вы увидите изображение гена миостатина, какие из гРНК будут вырезаны и в каком месте. Вот и все, теперь вы можете заказать свою любимую последовательность с парой других ингредиентов, что есть в любой обычной лаборатории клеточных культур, и создать функциональный вирус CRISPR за несколько недель.

 

Эмбрионы из-под генетических ножниц готовы

Развитие CRISPR настолько расширило возможности генетики, что даже чрезмерно мотивированные ученые едва успевают за последними достижениями. Технология CRISPR была впервые обнародована в 2012 году. В то время она использовалась только для разрезания ДНК в бактериях. Но уже в 2013 году появилась исследовательская работа, в которой CRISPR использовалась для одновременного изменения нескольких генов в эмбрионах мыши.

В 2015 году произошло большое событие. Впервые в истории науки китайские исследователи решились на генетическое изменение эмбрионов человека.

Исследователи начали свою работу на самой ранней стадии развития – с одной только что оплодотворенной яйцеклетки. Возможно, вы задаетесь вопросом, откуда они берутся. Обычно при экстракорпоральном оплодотворении остается несколько лишних оплодотворенных яйцеклеток. В некоторых странах их разрешено использовать непосредственно для исследований. В Австрии на это нет прямого разрешения, тем не менее на них все равно можно проводить исследования, если яйцеклетки импортированы из-за границы. Циники сказали бы, что это единственное по-настоящему поддерживаемое австрийским правительством интеграционное мероприятие. Каждое генетическое изменение, успешно выполненное в оплодотворенной яйцеклетке, будет передано всем клеткам развивающегося организма.

Ученые хотели исправить мутацию, которая нередко приводит к смертельному заболеванию крови. Они ввели систему CRISPR / Cas9 в 86 клеток и в течение двух дней ждали, когда CRISPR спокойно закончит свою работу. По истечении этого времени оплодотворенные яйцеклетки уже несколько раз поделились и переросли в крошечных эмбрионов, каждый из которых состоял из восьми клеток и был исследован генетиками. Однако результат не подарил праздничного настроения ни одному из ученых. Никого не пронесли через лабораторию на плечах и не забросали конфетти, потому что из 86 эмбрионов только у четырех было желаемое изменение гена, и даже у них генетическая модификация не была успешной во всех клетках организма. Кроме того, возникло много нежелательных мутаций, можно с уверенностью сказать, что первый научный блин был комом. И после всех неприятностей у исследователей снова возникли проблемы, на сей раз с поиском отраслевого журнала, который был бы готов опубликовать их работу. Изменение человеческих эмбрионов настолько противоречивая тема, что крупные журналы не хотели иметь с ней ничего общего. И это горько, потому что качество специализированного журнала для исследователей – что толщина золотой цепочки для пролетариата. Оно определяет самооценку и репутацию внутри сообщества. Два самых авторитетных журнала, Science и Nature, иногда отказывались публиковать подобные работы отчасти по этическим причинам. Вместо этого они издались в Protein & Cell. Это соответствует разнице между публикацией в качестве девушки месяца в глянцевом журнале и небольшим объявлением в церковной газете. При этом ученые приложили много усилий, чтобы минимизировать этические вопросы. Вместо того чтобы оплодотворять яйцеклетки с одним сперматозоидом в каждой, они брали те, в которых их было два. Такие зародыши могут нормально развиваться в течение нескольких дней, но затем неизбежно погибают. То есть они не смогли бы развиться в человека ни при каких обстоятельствах, даже если бы были имплантированы женщинам во время искусственного оплодотворения.

Хотя у генетически модифицированных эмбрионов было шаткое начало, это не остановило попытки других исследовательских групп добиться большего успеха. Не в последнюю очередь потому, что CRISPR предлагал новые возможности каждые несколько месяцев. В настоящее время исследования CRISPR на эмбрионах также проводятся в Лондоне или США. И к 2017 году многие проблемы, с которыми столкнулась китайская группа генетиков, были преодолены.

Из яйцеклетки, оплодотворенной сразу двумя сперматозоидами, эмбрион никогда не разовьется.

Международная исследовательская группа преуспела в исправлении мутации в эмбрионах, приводящей обычно к патологически утолщенной сердечной мышце. Во всех используемых эмбрионах генетическая модификация прошла успешно. Никаких нежелательных изменений генов обнаружено не было, и у всех до одного произошли изменения в каждой клетке организма. Интересно, что статья о результатах эксперимента была опубликована в престижном журнале Nature, хотя в этом случае использовались в основном оплодотворенные яйцеклетки, из которых теоретически могли развиться люди.

Хотя CRISPR очень прост в использовании, как говорится, дьявол кроется в деталях. Эксперименты с другими областями генов и заболеваниями готовят новые проблемы, и хотя уже были отдельные успешные исследования, все еще остаются препятствия, которые необходимо преодолеть, прежде чем генетическая модификация человеческих эмбрионов станет настолько надежной, что мы сможем характеризовать ее как безопасную. Однако, задумываясь о гигантских шагах, сделанных за последние годы, трудно поверить, что этот момент находится в далеком будущем. Профессор Гарварда Джордж Чёрч, сыгравший важную роль в разработке CRISPR, подытожил точность технологии в начале 2017 года так: «При помощи хорошей компьютерной программы, которая прогнозирует, в какую часть генома должны быть внесены изменения, вероятность ошибок будет ниже, чем вероятность спонтанных мутаций. Это означает, что дрянь, которая настигнет вас в воздухе, будет хуже».

Под этим он подразумевает, что солнечный свет, радиоактивность, загрязняющие вещества и другие вещи в нашей среде безостановочно вызывают больше неконтролируемых изменений в ДНК человека, чем хорошо спроектированный CRISPR.

Такой затруднительной генетическую модификацию делает не техническая сложность процесса надежного манипулирования генами. Большая проблема – наше ограниченное понимание собственного генома. Гены – это не усердно нанизанные рядом друг с другом на нить ДНК функциональные одиночки, как накачанный риталином ботаник на уроках математики. Они больше похожи на класс управляемых гормонами подростков во время большого перерыва, которые создают вид хаотичной толкучки, но при ближайшем рассмотрении становится ясно, с кем они хотят взаимодействовать, а с кем – нет.

В наших клетках царит сложная сеть взаимодействий, в которой многое взаиморегулируется и каждый ген вступает в контакт с большим количеством других компонентов клетки. Чтобы оценить последствия изменения гена, нам нужно научиться лучше понимать этот хаос. Если мы решим вмешаться в геном человека в ближайшее время, речь пойдет не о том, сможем ли мы надежно изменять гены, а о том, что мы действительно хотим изменить.

 

Что мы хотим оптимизировать?

Сначала плохая новость: независимо от того, насколько отчаянно вы пытаетесь оптимизировать себя путем генетических изменений, витаминных шипучих таблеток или занятием йоги по 16 часов в день, в конечном счете вы все равно умрете. Это может случиться очень быстро, и никто не знает когда. Может быть, хватит и того, что два раза в день вы посмеетесь до полусмерти. Или если в 19 лет неосторожно нанесете крем от морщин, который делает на 20 лет моложе. Финальной трагедии не избежать. Но было бы неплохо начать улучшать свою жизнь, делая ее немного дольше и приятнее, и не позволять Эболе, гепатиту и бешенству испортить вам настроение. Как стал бы хорош мир, если бы все вирусы можно было одним махом обезопасить для людей. Мир, в котором ротавирусы больше не вызывают взрывной диареи, в котором можно выйти из дома без мамочкиного крика «Оденься тепло!», потому что риновирусы больше не вызывают насморк. Мир, где генитальный герпес и ВИЧ больше не являются угрозой и худшее, что вам может подарить половой акт, – это ребенок. Одного этого должно быть достаточно, чтобы отбросить большую часть сомнений относительно селекционных детей.

 

Больше никаких вирусов

Пара исключительно авторитетных генетиков, включая вышеупомянутого профессора Гарварда Джорджа Чёрча, работают над проектом, благодаря которому вирусы однажды постигнет ужасный конец. Речь идет о создании клеток человека, которые не сможет поразить ни один вирус в мире. Цель этого проекта под названием Project Recode – создание устойчивых против вирусов и рака клеток. Это открытие станет настоящим благословением для биотехнологических предприятий, которым нужны человеческие клетки для производства лекарств. При этом Чёрч не скрывает, что теоретически технологии будут использоваться для создания полностью устойчивых к вирусу людей. Однако, чтобы это работало, нужно радикально переписать большую часть человеческого генома и коренным образом изменить код жизни. Причем таким образом, чтобы вирусы больше не могли использовать наши клетки для производства своего протеина.

Производство белка – одна из главных задач клетки.

Производство протеинов, проще говоря – белка, является одной из фундаментальных задач клеток. Сами протеины состоят из отдельных аминокислот. В каждом случае последовательность из трех букв ДНК определяет, какая аминокислота должна следующей встроиться в протеин. Например, последовательность букв ДНК GCC приводит к образованию аминокислоты валин, AAG образовывает лизин, CGG – аргинин и так далее. Если в ДНК следуют GCC AAG CGG, клетки образуют из этого белок, который начинается с аминокислот валин-глицин-аргинин. Последовательность из трех букв ДНК, которая определяет, какая аминокислота должна быть присоединена, называется кодон.

Всего из четырех букв ДНК (A, T, G, C) можно сформировать 64 разных кодона. Тем не менее для производства протеина наши клетки используют только 20 аминокислот. По этой причине наши клетки могут использовать разные кодоны для большинства аминокислот, каждая из которых ведет к одной и той же аминокислоте. Например, аминокислота глицин записывается не только кодоном GGC, но также и GGT, GGA и GGG. Это не было бы необходимо.

Цель Project Recode – исключить из генома лишние кодоны, чтобы для каждой аминокислоты был доступен только один кодон. В случае с глицином это может означать, что GGC будет выбран в качестве кодона в геноме и другие глицинообразующие кодоны (GGT, GGA и GGG) будут заменены на GGC. После этого можно было бы лишить клетку способности считывать три переписанных кодона, чтобы клетка могла читать глицин только в виде GGC. Таким же образом можно поступить с оставшимися аминокислотами, чтобы человек получил клетку, в которой каждая аминокислота записана при помощи ровно одного кодона.

Я надеюсь, что это не было слишком запутанно. Подводя итог, можно сказать, что генетический код будет сведен к функциональному минимуму. Но какое это имеет отношение к вирусам? Одна из причин, по которой нас настигают эти мучители, заключается в том, что они не могут сами производить протеин. Поэтому тайком проносят свой геном в клетки человеческого организма, чтобы мы могли связать их протеины вместе, формируя новые вирусные частицы. Это работает, потому что все живые существа и даже вирусы используют одни и те же кодоны. Будь то человек, африканская лягушка-бык или вирус герпеса, перед клеточным механизмом синтеза протеина мы все равны. Если генетический материал вируса, использующий несколько кодонов на аминокислоту, попадает в клетки, которые понимают только один кодон на аминокислоту, генетический материал захватчика будет полностью нечитаемым. Не имеет значения, будет ли это безобидный вирус простуды или страшнейший вирус-убийца, которого когда-либо видел свет. Генетическая информация была бы для клеток бессодержательной, и у вирусов не было бы шансов настолько радикально измениться в ходе эволюции, чтобы быть способными что-то с этим поделать. Цель исследователей – произвести клетки в течение следующих 10 лет. И поскольку, кажется, в этот момент все дойдет до точки, когда уже ничто не сможет повлиять на ситуацию, около 200 ученых, участвующих в проекте, размышляют над тем, чтобы наделить клетки устойчивостью к радиации, холоду, раку и механизмам старения.

Как же создавать из подобных клеток людей? В принципе, посредством обычной процедуры клонирования, которая уже довольно хорошо работает с животными. Генетический материал берется из яйцеклетки, которая затем оплодотворяется ядром устойчивой к вирусу клетки. Дальнейшие действия не будут сильно отличаться от обычного искусственного оплодотворения. Хотя на практике нужно было бы принять во внимание несколько дополнительных вещей, которые, впрочем, не являются серьезным препятствием, как нам не без оснований дает понять Джордж Чёрч.

Стоит признать, программа вакцинации, вероятно, является наиболее разумным вариантом защиты людей от вирусных заболеваний. Даже самые радикальные противники прививок вряд ли были бы готовы рассматривать такой вид селекционных детей в качестве альтернативы прививкам. И это несмотря на то, что противники вакцинации имеют большой опыт в принятии нерациональных решений. В настоящее время никто, кажется, всерьез не планирует производить людей таким способом. Но что будет значить чья-либо попытка сделать это? Даст ли кому-нибудь неоспоримое преимущество сертификат устойчивости к вирусам, когда тот ворвется на дискотеку? Могут ли эти люди претендовать на 25 % скидку от территориальной больничной кассы Вены? И будут ли они защищены от злых происков биотеррористов? Было бы вполне возможно создать вирусы, способные их инфицировать, если сделать вирусы таким образом, чтобы они использовали те же кодоны, что и клетки селекционных людей. Защита срабатывала бы только в случае столкновения с вирусами, образованными естественным путем. В этом тоже есть свои преимущества, потому что подобные люди все равно могли бы проходить вирусную генную терапию. В качестве ложки дегтя остается их неспособность производить несколько поколений потомков с людьми, не резистентными к вирусам. Недостатком при поиске партнеров у этих людей было бы то, что они даже не могли бы должным образом насладиться устойчивостью к заболеваниям.

Все живые существа используют одни и те же кодоны.

 

Переписать код жизни

Полностью переписать код жизни – звучит утопично, но уже в 2013 году из генома кишечной бактерии был удален один кодон с целью наделения его большей устойчивостью к вирусам. Для этого был изменен 321 участок ДНК бактерии, на котором появился этот кодон. Это была непростая задача, однако и она кажется смехотворной, учитывая, как минимум, 400 000 изменений в геноме, необходимых для производства устойчивых к вирусу клеток человека. К этому пока не готовы даже самые острые генетические ножницы в мире. Но, возможно, в этом нет такой уж необходимости. Если бы вам пришлось редактировать сочинение и изменять каждое второе слово, вы бы, наверное, предпочли написать текст заново. У генетиков – та же ситуация. Вместо того чтобы пытаться изменить ДНК на сотнях тысяч участков, они предпочитают генерировать совершенно новый геном. Замысел, известный как «полный синтез генома», является одной из самых амбициозных целей синтетической биологии.

Хотя до сих пор никому не удалось воссоздать человеческий геном из его основных строительных компонентов, мы все же приближаемся к этой цели широкими шагами.

Небольшой геном уже был создан. В 2008 году исследователи сформировали геном бактерии M. genitalium. Если вы внимательно прочитали название, вы уже догадываетесь, что речь идет не о какой-то там бактерии. M.genitalium любит уютно устроиться в половых трактах человека и одарить его чудесно зудящим воспалением мочеиспускательного канала. Тот факт, что исследователи выбрали геном именно венерического заболевания, не имеет ничего общего с сексуальной фрустрацией: дело в том, что M.genitalium обладает наименьшим известным геномом из всех организмов, способных самостоятельно размножаться. Два года спустя этой исследовательской группе удалось поместить полностью искусственно созданный бактериальный геном в клеточную оболочку без ДНК, которая затем начала размножаться и вести себя так, как и свойственно бактериям.

В настоящее время достигнут значительный прогресс в полном синтезе генома более сложных организмов, таких как, например, дрожжи, которые на молекулярно-биологическом уровне гораздо ближе к клеткам человека, чем бактерии. Как только мы сможем полностью воссоздать геном человека, перестанет иметь значение, требуется ли для воздействия на свойство одно изменение генома или сотни тысяч.

 

Что вообще означает «оптимизировать»?

На данный момент исследования возможных генетических изменений в основном направлены на борьбу с неизлечимыми наследственными заболеваниями. Но даже при этом неочевидно, что можно постоянно говорить об оптимизации. Давайте снова возьмем Джорджа Чёрча в качестве примера. Бородатый мужчина – один из самых дальновидных генетиков нашего времени. В дополнение к полномасштабному синтезу генома он работает над возрождением шерстистых мамонтов, разведением свиней, чьи органы не отторгаются иммунной системой человека при трансплантации, и аналогичными революционными проектами. Чёрч делает все это, несмотря на свою нарколепсию – расстройство нервной системы, в народе называемое сонной болезнью. И нет, вы не страдаете нарколепсией только потому, что не хотите вставать утром. Вы просто ленивы. Чёрч же, наоборот, старается вставать, когда это возможно, и потренироваться с гирями, чтобы предотвратить нежелательное засыпание. Тем не менее увидеть Джорджа Чёрча в течение дня задремавшим не редкость. Насколько продуктивнее мог бы быть генетик, если бы ему не приходилось постоянно бороться с приступами нарколепсии?

Дрожжи на молекулярно-биологическом уровне гораздо ближе к клеткам человека, чем бактерии.

Вопрос, вводящий в заблуждение. Почти все провидческие идеи и решения научных проблем приходили Чёрчу либо во время сна, либо в полудреме, либо в начале или конце нарколептического приступа. «Мне потребовалось 50 или 60 лет, чтобы осознать, что моя нарколепсия – это не дефект, а способность», – сказал Чёрч.

Чёрч – не единственный гений, расстройства нервной системы которого считают полезными для достижения значительных результатов. Когда Чарльз Дарвин вернулся в Англию после своей исследовательской экспедиции, у него начались такие сильные панические расстройства и страх перед широкими площадями, что всю оставшуюся жизнь он провел как отшельник. Его неспособность участвовать в общественной жизни позволила посвятить все время и энергию развитию теории эволюции. По письмам Людвига ван Бетховена легко понять, что маниакальная депрессия больше окрыляла его композиторское творчество, чем тянула вниз. Пожалуйста, не поймите меня неправильно, я не возвеличиваю психические проблемы. Для большинства людей они означают в основном повседневные трудности и страдания. Один лишь факт, что Джордж Чёрч придумал великие идеи при помощи нарколепсии, совсем не означает, что так будет у всех. Нельзя забывать, что Чёрч – гений, а идиот с нарколепсией – просто сонный идиот.

Пребывание мозга в исключительном состоянии может оказаться полезным в разработке исключительных идей.

В целом, однако, высокий показатель нейроразнообразия должен быть пригодным для общества. Это означает, что в нем присутствуют умы, которые работают немного иначе, чем у большинства. Высокофункциональные аутисты, люди с обсессивно-компульсивными расстройствами или СДВГ в некоторых областях могут хорошо справляться с поиском решений, к которым другим прийти трудно. Поэтому сложно определить, какое состояние наиболее оптимально. Для Чёрча нарколепсия – это приз, за который он, видимо, охотно расплачивается. Но, даже не беря в расчет нарколептических гениев, оптимизация людей усложняется тем фактом, что свойства не зависят друг от друга и что изменение одного свойства часто оказывает незапланированное влияние на другие.

 

Все имеет свою цену

Представьте, что вы были генетически изменены таким образом, что улучшилась ваша кратковременная память. Поначалу звучит здорово, но люди с превосходной кратковременной памятью заскучают быстрее, например, при многократном посещении картинной галереи или прослушивании музыки. Таким образом, генетическое изменение для улучшения краткосрочной памяти вполне можно назвать изменением в пользу быстрого наступления скуки. Будет ли это теперь оптимизацией или нет? Но может быть, вас не интересует эффективность памяти, и вы охотнее повысили бы свою креативность, потому что в детстве замечали, что ваша мама прикрепляет на холодильник отвратительные цветные рисунки исключительно из вежливости. В этом случае, пожалуйста, имейте в виду, что несколько исследований обнаруживают связь между творческим потенциалом и повышенным риском психических заболеваний. Еще 2000 лет назад римский философ Сенека Младший написал: «Никогда не было великого ума без примеси безумия». Уместное высказывание для времен, когда самые яркие умы во время коллективного посещения туалета подтирались общей губкой.

Но современные исследования доказывают, что Сенека прав. Люди, страдающие тяжелой шизофренией или биполярным расстройством, часто несут такой большой груз страданий, что сами по себе не могут творить много креативного. Но доза определяет яд, и может случиться так, что «дуновение» психического расстройства на самом деле вдохнет жизнь в творческие способности. Большое исследование показало, что творческие профессии изобилуют членами семей людей с шизофренией или биполярным расстройством – например, среди актеров, танцоров или музыкантов. Это может быть связано с тем, что члены семей пациентов, хотя и обладают парой ответственных за это вариантов генов, все же они не позволяют шизофрении или биполярному расстройству проявляться заметно. Другие исследования обнаружили более конкретную связь, показывающую, что люди в творческих профессиях чаще имеют варианты ДНК, связанные с шизофренией или биполярным расстройством. Творчество – это палка о двух концах. Оно базируется на способности устанавливать связи между вещами, к которым другие не приходят. При этом люди двигаются по очень тонкому канату, балансируя между функциональным мастером, деятелем искусств, и сторонником теории заговора в шапочке из фольги.

Связь между творческим потенциалом и повышенным риском психических заболеваний научно доказана.

Подобные компромиссы между желательными и проблемными чертами могут широко распространиться в генетике. Уже в 1999 году исследователи попытались улучшить память и способность к обучению мышей, введя ген в субъединицу рецептора мозга животного. Интеллект мышей на самом деле мог бы вырасти, но они также были более предрасположены к хронической боли. Эта попытка впервые показала, что генетические основы способности к обучению, производительности памяти и болевые ощущения, по крайней мере, частично пересекаются.

С уверенностью можно сказать, что многие черты связаны друг с другом теснее, чем нам известно в настоящий момент. Потому улучшение одного свойства неизбежно повлечет за собой изменение других. Уже хотя бы по этой причине не может существовать что-то вроде идеального генома. Тем не менее нельзя отрицать, что некоторые варианты генов в жизни более полезны, чем другие, и что люди могут извлечь выгоду из оптимизации отдельных свойств. И все же следует подумать дважды, к каким свойствам это применимо. Например, вы можете заменить версию вашего гена ABCC11, которая отвечает за сухую ушную серу, на ту, что сделает ушную серу влажной. Цена, которую вы заплатили бы за это, – более сильный запах тела и худшая реакция на химиотерапию. Сделка такая же никудышная, как договор на мобильную связь 1998 года. Существует не так много признаков, которые определяются одним геном, и те немногие, что существуют, обычно не впечатляют. Кого вообще волнует, есть ли у человека генный вариант, который определяет, сможет ли он почувствовать горечь в брокколи? У брокколи в любом случае вкус размоченного картона.

Генетическая основа способности к обучению и болевые ощущения пересекаются.

Большинство свойств, которые было бы выгодно улучшать, имеют генетическую основу, которая рассеяна по всему геному. Например, свойство, которое сильно удручает меня, когда думаю об истории своей семьи: выпадение волос у мужчин преклонного возраста.

На сегодняшний день известна 71 область генов, которые влияют на то, будет ли мужчина в течение жизни терять волосы.

И даже 71 генная область может объяснить наследование лысины только у 38 % мужского населения. Тут даже не стоит распаковывать генетические ножницы. Если кто-то все же захочет потратиться и повлиять на человеческие качества, ему стоит сконцентрироваться, по крайней мере, на том, что нельзя скрыть под головным убором: свойства, которые влияют на нашу жизнь более существенно, чем консистенция ушной серы, и имеют сильное генное запечатление. Эти свойства – личность и интеллект.

Но прежде чем мы решимся приступить к упомянутой теме, я хотел бы отделаться парой предостерегающих слов, чтобы вы не звонили в полицию каждые несколько страниц, чтобы донести на меня. Я биолог. Как биолог, я испытываю необычайный интерес к той части феномена, которая имеет биологическое основание. Особенно, когда задействована генетика. Поэтому может случиться так, что я, например, напишу, что различные значения артериального давления у взрослых на 60 % объясняются генетически. Что еще хуже, я мог бы продолжить и неуемно писать об этих 60 %, тогда как не обусловленные генетикой 40 % упоминаются только мельком. Пожалуйста, не поймите это превратно. «Модер говорит, давление из-за генетики, хватит меня дурить», – это неправильный вывод. То, что некоторые части этой книги фокусируются на генетических факторах, не означает, что другие факторы влияния не играют значительной роли.

Может быть, вас не слишком волнует гипертония, но когда речь заходит о таких темах, как интеллект и личность, представление о том, что существуют генетические факторы, влияющие на них, является стопроцентным триггером недовольства. Думаю, это связано с тем, что суждение о существовании генетических факторов воздействия любят приравнивать к словам: «ТОЛЬКО ГЕНЫ ИМЕЮТ ЗНАЧЕНИЕ, ДАЖЕ НЕ ПЫТАЙТЕСЬ, БИОЛОГИЧЕСКИЙ ЭССЕНЦИАЛИЗМ НАВСЕГДА». Это, конечно, тоже неуместное заключение. Но, будем честными, что бы вы предпочли: в пятидесятый раз услышать, что воспитание важно для развития личности и прилежно учиться полезно для интеллекта, или узнать ту часть истории, с которой вы, вероятно, еще не знакомы?

 

Интеллект: предпосылки и побочные эффекты


Представьте, что вы можете выбрать, в какое животное переродиться. Что бы вы выбрали? Хотели бы быть птицей, чтобы исследовать небо и гадить нарушителям спокойствия на головы? Или лучше слоном, потому что внезапно осознали, насколько важно иметь возможность подбирать вещи носом? Я уважаю ваши наивные желания, но лучшим решением, несомненно, будет асцидия. У этих похожих на головастиков личинок простые глаза, спинной мозг и примитивный головной мозг. Едва вылупившись, они проплывают сквозь мировые океаны в поисках места, где можно засесть на долгое время. Это может быть корпус корабля, камень или морское дно, к которому животное прикрепляется навсегда. Правда, в этом состоянии асцидии никак не используют свой мозг. Они просто уменьшают его в размере, переваривая внутри себя. Таким образом, асцидия разработала универсальное решение всех проблем, которые могут возникнуть в жизни: если все становится слишком бессмысленным, нужно просто где-нибудь залечь, и мозг постепенно исчезнет, а человек при этом не упадет замертво. Стресс на работе? Освободитесь от мыслей в каком-нибудь углу. Нет настроения готовиться к экзамену? Долой мозг! Вообще-то асцидия должна быть покровителем каждого семинара по медитации, где освобождение от мыслей проповедуется как высший идеал. Однако она служит не просто духовным лидером. Она также наглядно демонстрирует, что мы думаем не только потому, что мысли такие восхитительные, а из чисто прагматических соображений выживания.

Ничто не может быть более безразличным природе, чем то, раскроем ли мы замысел и великие тайны вселенной или нет. Главное, что мы достаточно умны, чтобы не прищемить хвост саблезубому тигру.

 

Завышенная самооценка – гарант успеха

Причина, по которой мы чувствуем себя настолько умными, заключается в том, что другие существа еще глупее. Очень обольстительно считать себя башковитым, будучи представителем вида, который полетел на Луну и обнаружил бозон Хиггса. Но вот лично вы вообще знаете, как работает смыв в туалете? Серьезно, пожалуйста, подумайте об этом пару минут, или, что еще лучше, нарисуйте. Позволяя участникам исследования оценить, насколько хорошо они понимают способ функционирования таких вещей, как клавиши пианино, швейная машина, велосипед или смыв унитаза, большинство относят свои знания к категории «довольно хорошие». Но если попросить их подробно описать, как все эти вещи работают, или даже зарисовать это, участники поймут, насколько ничего не подозревающими они являются, и оценят свои знания ниже, чем прежде. Кто знает, возможно, высказывание Сократа «Я знаю, что ничего не знаю» родилось после проваленной попытки изобразить смыв унитаза.

Другими словами, мы слишком глупы, чтобы понимать мир вокруг нас, но это не имеет значения, потому что мы слишком глупы, чтобы понимать, что мы слишком глупы. В науке этот феномен называется «иллюзией глубины объяснения» (англ. Illusion of Explanatory Depth – IOED). Так не было бы с нашей стороны более разумным решением реально оценивать собственные умения? Нет. По крайней мере, если верить американскому психологу-эволюционисту Роберту Триверсу, которого считают иконой в области исследований обмана и самообмана. Долгое время психологи придерживались мнения, что мы переоцениваем свои возможности только для того, чтобы почувствовать себя лучше. Но с точки зрения эволюции, на самом деле не имеет значения, считаем ли мы себя замечательными или так себе, важны преимущества выживания и репродуктивная функция. У Триверса другое объяснение: мы обманываем себя, чтобы лучше обманывать других. Способность убеждать других в том, что вы особенно классный, может быть полезной. Но сознательный обман вызывает напряжение, и велика опасность, что люди обнаружат неправду. Но если мы действительно считаем себя лучше, чем есть на самом деле, нам будет легче убедить в этом и других. Исследование показало, что люди, которые переоценивают себя, другим кажутся особенно компетентными и имеют более высокий социальный статус. Поэтому гораздо полезнее считать себя большим интеллектуалом, чем есть на самом деле.

Самообман заложен в нас в частности для лучшего обмана других. Интеллект – это еще не все

Но если мы не просто хотим чувствовать себя компетентными, а на самом деле понимать, как устроен окружающий мир, мы должны быть готовы регулярно выбрасывать свои неправильные представления за борт. В науке это называется «верификацией», то есть проверкой различных возможностей объяснения и отбрасыванием тех, которые оказываются ложными. Другими словами, вы должны позволить ошибочным теориям умереть, чтобы внедрить теории правильные. Австрийский философ сэр Карл Поппер, являющийся отцом принципа верификации, касательно этого выразился радикально: «Пусть умирают теории, а не люди!» Правда, он все равно умер. Положа руку на сердце, когда в последний раз вы в корне изменили свое мнение по теме, потому что столкнулись с лучшими аргументами? Если подумать, найти пример совсем непросто.

Последний раз, когда я сознательно изменил свое мнение, касался интеллекта. Я был убежден, что результаты тестирования уровня интеллекта ничего в себе не несут, потому что тесты на интеллект не измеряют ничего, кроме того, насколько хорошо человек может делать тесты на интеллект. Я думал, что наша генетика не оказала существенного влияния на то, насколько мы разумны. Подобные заявления в разговорах о человечком интеллекте довольно часты. Но большинство из них исходят от людей, которые либо всерьез не занимались исследованиями интеллекта, либо отвергают их по идеологическим причинам. Но если хочется знать, можно ли улучшить интеллект человека, сначала нужно усвоить, что такое вообще интеллект, как его достоверно измерить и почему результаты тестов интеллекта ни в коем случае не являются бессодержательными.

Тесты на интеллект не предназначены для того, чтобы свести значимость человека до цифры. Когда я измеряю обхват вашего бицепса, я не говорю, что все остальные ваши черты не имеют значения. Прежде всего тестирование интеллекта говорит о том, насколько быстро удается решить новое сложное задание. Это очень полезно в жизни и совершенно нейтрально с моральной точки зрения. Есть бесчисленное множество других качеств, которые можно и нужно ценить в человеке: смелость, мудрость, добродетель, способность воодушевляться, доброта, юмор и так далее. Но ни одно из них и близко не изучено так же хорошо, как интеллект, не говоря уже об их биологических основах. Тем не менее существует так много мифов касательно этой темы, что около 80 % самых популярных вводных книг по психологии содержат ложные утверждения по поводу интеллекта, как показали исследования 2018 года. Но теперь пришло время столкнуться с неопровержимыми фактами.

Прежде чем углубиться в такую каверзную тему, как исследование интеллекта, мы должны ненадолго прерваться и поговорить о слове, которое часто будет встречаться в этой книге, – «корреляция». Без нее статистика, какой мы ее знаем сегодня, просто немыслима. Большинству людей это слово, возможно, уже встречалось, но мало кто знает, что его создатель – человек, который считается не только праотцом статистики, но и основателем исследований интеллекта, разработавшим концепцию корреляции именно для этой цели.

 

Открытие корреляции

В 1880-х годах естествоиспытателя Фрэнсиса Гальтона часто видели прохаживающимся по улицам Великобритании, в то время как сам он пристально смотрел вслед каждой женщине, рьяно возясь в своих штанах. Во имя науки, разумеется. В кармане его брюк находился аппарат, с помощью которого он мог фиксировать, какие показатели – по шкале красоты от привлекательной до отталкивающей – он приписывал проходящим мимо женщинам. После нескольких месяцев кропотливого сбора данных он создал карту красоты Британских островов (если вы находитесь поблизости: Лондон на первом месте, Абердин завершает список, не благодарите). Едва ли можно проиллюстрировать более ярко, что выдача средств на научные исследования в то время контролировалась исключительно мужчинами.

Тест на интеллект в первую очередь определяет способность решать нетипичные новые задачи.

Гальтон с большим рвением пытался измерить все, что хоть как-то возможно было измерить. Он регулярно посещал лекции своих коллег и отмечал наклон головы студентов, чтобы определить, чьи доклады самые скучные. Коллеги, вероятно, питали к нему те же теплые чувства, что и дамы из Абердина. Создается впечатление, что Гальтон обладал необычайной научной энергией, не зная точно, что с ней делать. Правда, это резко изменилось, когда его троюродный брат Чарльз Дарвин опубликовал свою книгу по теории эволюции. Во время чтения Гальтона особенно впечатлил пример Дарвина, в котором описывалось, как фермеры улучшили характеристики скота с течением времени. «Если бы только одна двадцатая часть затрат и мучений, отданных на улучшение способов разведения лошадей и крупного рогатого скота, была вложена в улучшение человечества, какую галактику гениев мы могли бы создать!» – написал Гальтон в своей статье 1864 года. Он был одержим идеей усовершенствования человеческого рода посредством обдуманного размножения. Для этого он хотел выяснить, что позволяет человеку подняться на вершину общества. Хотя наибольший интерес для него представляло изучение наследования интеллекта, Гальтон осознавал, что в то время его едва ли можно было измерить. Поэтому сперва он сосредоточился на наследовании физических характеристик, таких как рост, которые очевидно имели наследственный компонент. Для этого ему нужен был математический метод сравнения вещей, имеющих неявную связь друг с другом. До этого момента, однако, наука была в состоянии описать только относительно прямые связи между причиной и следствием, которые, увы, редко обнаруживаются в природе, где многие факторы взаимодействуют хаотичным образом.

В связи с этим Гальтон разработал концепцию корреляции, представляющую собой взаимосвязь между двумя или более показателями, которые, хотя и не имеют прямого отношения друг к другу, кажутся взаимосвязанными. Корреляция позволила ему приблизительно спрогнозировать одно (рост ребенка) на основе другого (рост родителя) и понять, насколько тесно связаны эти две величины. Таким образом, Гальтон не только разработал концепцию, без которой трудно представить современную статистику, но и заложил основу для изучения наследования сложных человеческих характеристик.

Троюродный брат Чарльза Дарвина был одержим идеей усовершенствования человечества путем обдуманного размножения.

Насколько две величины взаимосвязаны, можно описать с помощью коэффициента корреляции r. Если существует положительная корреляция, значение r находится в диапазоне от 0 до 1. Чем более совершенно сходство измеряемых величин, тем ближе r приближается к значению 1. Если, например, на сантиметр длины волос расходуется ровно один миллилитр шампуня, корреляция между длиной волос и необходимым количеством шампуня будет r = 1. Однако, если два показателя полностью независимы, r будет равен 0, скажем, если рассчитывать корреляцию между количеством волос в носу и температурой поверхности Солнца. Чем сильнее коррелируют два показателя, то есть чем ближе значение r приближается к 1, тем выше вероятность того, что они будут зависеть от одного или нескольких общих факторов. Теперь, вооружившись этими знаниями, мы можем посвятить себя исследованию интеллекта.

 

Определение интеллекта

Термин «интеллект» часто критикуют за то, что он настолько размыт, что для него не может быть никакого толкового определения. Потому было бы бессмысленно измерять интеллект или даже сравнивать интеллект одного человека с другим. Но если вы заглянете глубоко внутрь себя, то обнаружите, что и у вас есть интуитивное определение интеллекта. Даже если вы никогда конкретно его не формулировали. При этом замечаете, что способны определить, когда кто-то не так умен, как вы. Если вы когда-нибудь в жизни называли кого-то идиотом, в этом пункте вы автоматически делаете меня правым. С другой стороны, вы оскорбляете людей, которые умеют больше, чем вы, предположу, такими словами, как «зубрила», «ботаник» или «очкарик», чтобы сделать из своего собственного идиотизма достоинство. Будучи жителем Вены, я, естественно, считаю желательной и легитимной идею определения интеллекта посредством использования ругательств. Большинство ученых, однако, предпочитают определения, использование которых не влечет за собой взбучку. Существует несколько общепринятых определений интеллекта, но наиболее распространенным среди исследователей является определение американской исследовательницы интеллекта Линды Готтфредсон:

«Интеллект – это весьма общая умственная способность, которая – помимо прочего – включает возможность делать заключения, планировать, решать проблемы, абстрактно мыслить, понимать сложные идеи, быстро обучаться и учиться на основании опыта. Это не просто изучение книг, узкие академические знания или навыки проходить тесты. Кроме того, интеллект отражает более широкое и глубокое умение познавать окружающий мир: “смекать”, “постигать суть вещей и соображать” или “делать вывод на основе сложившейся ситуации”».

Определение столь же изящно, как неокрашенный мешок картофеля. Но было бы так же удивительно, если бы нечто такое сложное, как человеческий интеллект, можно было адекватно описать в нескольких словах. Так как же измерить нечто такое многослойное, как человеческий интеллект? Вероятно, первое, о чем вы подумали, это классический тест IQ. И вы правы!

 

Тест IQ

Причина, по которой люди, опираясь на науку, пытаются максимально точно измерить интеллект, кроется в том, что едва ли существует другой показатель, с помощью которого так хорошо можно предсказать успех в жизни во многих областях. Немецкий психолог Детлеф Рост справедливо определяет интеллект как «наиболее изученный признак психологии».

Тем не менее тестирование интеллекта вне исследований часто называют несерьезным и бессмысленным. Всё потому, что многое из называемого тестом на интеллект не имеет к этой области никакого отношения. Классический способ определения коэффициента интеллекта (IQ) посредством серьезного теста может занять несколько часов и требует присутствия обученного экзаменатора.

В Интернете же вы найдете множество тестов, которые утверждают, что вы можете определить свой IQ путем решения каких-нибудь головоломок в течение десяти минут. Однако это имеет больше общего с тестом из журнала «Браво» вроде «Кто ты из Backstreet Boys?», а не с настоящим тестом на уровень интеллекта.

Настоящий IQ-тест работает по-другому. На выполнение даются различные задачи, проверяющие эффективность работы в нескольких областях, обычно это логическое мышление, понимание речи, кратковременная память, скорость обработки информации и пространственное мышление. Результаты теста в основном не зависят от текущего состояния, потому что постановка задач, которые дают очень разные результаты при тестированиях (r < 0,80 – в случае, если вы были внимательны), не будет включена в стандартизированные тесты IQ. Если проводится так называемый адаптивный тест, сложность задач постоянно адаптируется к производительности испытуемого, чтобы определить, где находится ее предел. В адаптивных тестах задачи чаще всего очень сложные или вообще нерешаемые. Независимо от того, насколько человек сообразителен, после адаптивного теста он неизбежно чувствует себя неудачником и зачастую изумляется результату, что все же не является полным идиотом. Так что не отчаивайтесь.

После прохождения вами всех тестов экзаменатор может перейти к вычислению показателя IQ. Для этого результаты проведенных испытаний суммируются и сравниваются с результатами, полученными другими людьми. Здесь кроется принципиальное различие между результатами тестов IQ и другими показателями. Показатель интеллекта не может быть дан как абсолютное значение, как, например, «пять литров воды», – он всегда дается в сравнении результатов теста тысяч других людей. Тест IQ показывает, насколько лучше или хуже ваши результаты по сравнению со средним показателем, который определяется как значение IQ 100. Около 70 % всех людей попадают в средний диапазон со значениями IQ от 85 до 115. Начиная со 130 человек считается высокоодаренным, к коим относится примерно 2 % населения.

В этой системе оценивания есть ответ на излюбленное обвинение в том, что тесты IQ будут измерять только то, что разработчики тестов считают важным. Это было бы справедливо, если бы отдельные задания оценивались произвольно, как домашнее упражнение. Однако в одном тесте на интеллект вы получаете совокупность тестов, исследующих пределы вашей производительности при помощи различных задачек для ума. При этом баллы за решаемые задачи не начисляются случайным образом, и эффективность вашего мышления сравнивается с показателями многих других людей, прошедших тот же тест. Поэтому IQ от 135 не означает, что разработчик теста особенно доволен вашими результатами – это означает, что ваши способности лучше, чем у 99 % всех людей, которые прошли этот же тест. IQ от 146 говорит о том, что, в среднем, вы справились лучше, чем 99,9 % всех людей. Нейтральная оценка не представляется возможной.

В адаптивных тестах IQ бывают вообще нерешаемые задачи – для определения предела возможностей.

Тем не менее на этом моменте вы можете испытать некоторое недоумение. Как можно получить в результате теста одно число, если проверяются разные области интеллекта независимо друг от друга? Как быть с людьми, у которых исключительное понимание речи, бешеная скорость обработки информации, мощная кратковременная память, вот только о логическом и пространственном мышлении они знают лишь понаслышке? А как насчет людей, чей мозг демонстрирует блистательные вербальные навыки при заказе в ресторане, но чья функциональность полностью прекращается, как только приходится делить счет? Возражение было бы оправданным, если бы не самый важный и наиболее изученный феномен исследования интеллекта: g-фактор.

 

G-фактор интеллекта

Тест IQ содержит разнообразные постановки задач, которые, по-видимому, оценивают различные умственные способности. Интуитивно можно предположить, что при этом каждый человек покажет особенно хорошие результаты в одних областях, в других – возможно, отвратительные. Наверное, вы знаете кого-то, кто является непревзойденным лидером, когда дело касается мысленного вращения раскрашенных предметов, но чьи языковые навыки похожи на разговор Ходора из «Игры престолов» и Грута из фильмов «Марвел». Хотя такие люди действительно существуют, они, скорее, исключение. Вероятно, наиболее важный вывод из более чем столетнего исследования интеллекта такой: люди, которые хорошо справляются с тестом на умственное развитие, обычно хорошо проявляют себя во всем.

В ходе эволюции могло сложиться иначе. Например, люди с особенно хорошей кратковременной памятью могли быть плохи в логическом мышлении. Или быстрая реакция была бы компенсацией хорошей памяти. Или что все эти категории интеллекта были бы полностью независимы друг от друга. Но это не так, даже если того желают приверженцы альтернативных моделей интеллекта.

Некоторые исследователи даже разрабатывали тесты на интеллект, задачи в которых были специально подобраны с целью полной рассогласованности отдельных разделов теста. Однако им это не удалось.

Каждый раз выяснялось, что люди, которые показывают незаурядные результаты в одной из категорий интеллекта, как правило, хорошо проявляют себя и в других.

Логическое мышление, понимание речи, кратковременная память, скорость обработки информации, пространственное мышление – результаты отдельных тестов коррелируют.

Кажется, будто есть лежащий в основе интеллекта фактор, который участвует во всех этих, казалось бы, разных тестах на уровень интеллекта. Так оно и есть. Это общий фактор интеллекта, или g-фактор. Именно он – базовый для всех категорий интеллекта, что придает показателю IQ его значимость.

Хотя IQ – это не то же самое, что g-фактор, они все же довольно близки. Если исследователи говорят об «интеллекте», они обычно имеют в виду g-фактор или результаты тестов IQ, позволяющие сделать выводы о g-факторе. Существование значимого g-фактора является одним из наиболее обоснованных выводов психологических исследований. И хотя существуют разные объяснительные модели, никто по-настоящему не знает, что на самом деле лежит в основе g-фактора и почему он вообще существует.

Но что мы можем себе вообразить? Мысленный эксперимент: вы идете в фитнес-студию и спрашиваете пару атлетов, можно ли вам их измерить. Они, естественно, с радостью соглашаются, потому что посетители фитнес-студий радуются вниманию во всех его проявлениях, особенно если их называют атлетами. Помимо этого вы измеряете несколько менее спортивных людей на улице. Вы измеряете мышечную силу верхней части тела, ног, объем легких, индекс массы тела (ИМТ), время, за которое человек пробежит дистанцию в 100 метров, и так далее. При этом замечаете, что отдельные показатели участников эксперимента не являются независимыми друг от друга. Они коррелируют. Люди с низким ИМТ имеют тенденцию делать больше отжиманий, бегать быстрее, и у них больше объем легких по сравнению с людьми, обладающими высоким ИМТ. Людям, которые делают 40 отжиманий, будет проще пробежать марафон, чем тем, кто рухнет уже на первом испытании.

Вы бы заметили, что люди, демонстрирующие особенно хорошие результаты в одной категории, в среднем, склонны показывать их и в другой. Дело в том, что отдельные показатели основаны на общем факторе: фитнесе. Фитнес – это что-то неконкретное, нематериальное, но несущее информацию о том, насколько высоко мы прыгаем, далеко бегаем и какой вес можем поднять над головой. Успехи в фитнесе нельзя определить с помощью одного теста. Однако, если вы оцениваете несколько достижений, связанных с ним, общая картина даст то, что мы называем фитнесом. То же самое и с g-фактором, лежащим в основе отдельных категорий интеллекта. Если хотите, можете думать о g-факторе как об общем фитнесе мозга. Или ментальной результативности. Или для краткости скажите просто – интеллект.

Когда ученые говорят об «интеллекте», обычно имеют в виду g-фактор – абстрактную основу умственных способностей.

 

Так все-таки для чего нужны исследования интеллекта?

Но зачем все это исследовать? Чтобы какой-нибудь ботаник бравировал словами «мой больше, чем твой», когда разговор заходит о результатах теста IQ? Или они действительно имеют значение для будущей жизни? Если то, что тестирование интеллекта не измеряет ничего, кроме способности делать тесты на интеллект, является правдой, их результаты не должны иметь четкой связи с дальнейшим успехом в жизни. Все же это не тот случай. Вот несколько особенно хорошо изученных областей, в которых существует корреляция между показателями IQ и успехом.

Успеваемость в школе: в одном из крупнейших исследований этой темы были определены показатели IQ более 13 000 школьников в возрасте 11 лет, которые были сопоставлены с результатами стандартного школьного теста, проведенного пять лет спустя. При этом проявилась очень сильная корреляция между высокими показателями IQ и хорошо сданными экзаменами, что лишь изредка встречается в психологических исследованиях (r = 0,81). Между тем появились сотни исследований, подтверждающих эту связь.

Профессиональный успех: высокие показатели IQ коррелируют с лучшей результативностью на рабочем месте. Независимо от того, как измеряется производительность, будь то доход, продуктивность, эффективность или оценки начальников. Взаимосвязь между IQ и результативностью ярче проявляется в сложных профессиях по сравнению с простыми.

Повседневная жизнь: сравнения групп с низким IQ (75–90) и групп с высоким IQ (110–125) показали разные риски в разных жизненных ситуациях. Вероятность прерывания обучения в средней школе в 133 раза выше в группе с низким IQ. У людей этой группы в 10 раз выше риск долгосрочной зависимости от социальной помощи, в 7,5 раза выше риск попадания в тюрьму и в 6,2 раза выше риск бедности. Безработица, вероятность попадания в дорожно-транспортное происшествие и даже разводимость также повышены в группе с низким IQ.

Здоровье: люди, которые показывают хорошие результаты в тестах на уровень интеллекта, больше занимаются спортом, лучше питаются и реже курят. Они не так часто страдают от болезней сердца, ожирения и гипертонии. У людей, которые получили особенно плохие результаты в тесте IQ, риск умереть в течение следующих 20 лет в три раза больше, чем у людей в группе с особенно хорошими показателями. Это показало исследование, в котором приняли участие почти миллион шведов. Кроме того, эта обзорная работа приводит к заключению, что увеличение на 15 баллов IQ в детстве снижает риск смерти в последующие годы на 24 %. Этот факт не изменился, когда исследователи рассчитали такой фактор, как социально-экономический фон детей.

Соотношение между результатами теста на уровень интеллекта и всеми перечисленными факторами воздействия более сложное, чем указано в этом списке. Например, не только высокий интеллект ведет к крепкому здоровью, но и крепкое здоровье также может способствовать повышению уровня интеллекта. Исследователи это знают и тратят много сил, чтобы учесть все потенциальные факторы. Но даже если исключить возможные источники влияния, такие как социально-экономический статус, возраст, пол и т. д., взаимосвязь сохраняется. Что еще более отчетливо подтверждает легитимность тестирования интеллекта, так это то, что его результаты коррелируют с такими характеристиками, как толщина и скорость обмена веществ коры головного мозга. Опытные игроки в тетрис не только лучше играют, их мозг в это время потребляет меньше энергии, чем мозг новичков. Это происходит из-за того, что он стал более эффективным в освоении игры и ему требуется меньше усилий. Измерение мозговой активности людей во время проведения тестов на уровень интеллекта также обнаруживает различия в потреблении энергии. Мозгам людей с лучшими результатами тестирования интеллекта требуется меньше энергии для решения задач, чем мозгам тех, кто справился хуже. Их мозги более эффективны в решении сложных вопросов и напрягаются при этом меньше. Если бы результаты тестирований интеллекта были бессмысленными, такого бы не было.

Люди с высоким IQ, как правило, больше занимаются спортом, лучше питаются и реже курят.

Все это лишь верхушка айсберга феномена человеческого интеллекта. Я знаю, что можно рассказать об этом гораздо больше, но моей целью было поведать о двух вещах: есть один общий фактор интеллекта (g-фактор), который влияет на производительность в самых разных интеллектуальных задачах. Современные тесты на уровень интеллекта пытаются как можно точнее определить этот фактор, и успех, здоровье, социально-экономический статус и другие жизненно важные сферы жизни с ним связаны.

Для полноты картины я хотел бы отметить, что, похоже, существует связь между высоким интеллектом и ношением очков. Поэтому, если вы побежали в ближайший филиал Fielmann, полагая, что с очками вы становитесь умнее, пожалуйста, забудьте предыдущее предложение – оно вас не касается. Интеллект является крайне многообещающим в плане оптимизации свойством человека. Вряд ли что-то еще может одновременно улучшить жизнь в таком большом количестве сфер. Трудно представить ситуацию, в которой более низкий интеллект имел бы преимущество перед более высоким. Разве что на хэви-метал-концерте, потому хедбенгинг делается быстрее легкой головой.

 

Не так страшны генетические влияния

Если речь идет о повышении уровня интеллекта, то в основном исключительно посредством образования и целенаправленного стимулирования. Логично, потому что этими возможностями можно управлять, а генетикой – нет. По крайней мере, пока. Однако с приближающейся способностью изменять геном генетический аспект интеллекта может возыметь беспрецедентную значимость.

Тема не из легких. К вопросу генетической основы интеллекта относятся так же, как к 30-летнему сыну католической консервативной семьи, который носит слишком узкие брюки и никогда не приводил домой девушку: все чувствуют, что вопрос повис в воздухе, но никто не хочет быть тем, кто его задаст. Тот факт, что тема генетики часто опускается в дискуссии об интеллекте, имеет вполне обоснованные исторические причины.

Прошлое показало, что есть достаточно мерзавцев, полета мысли которых хватает на то, чтобы наукой оправдать собственный сексизм, расизм и другие проблемные идеологии.

Поэтому неудивительно, что исследователей часто обвиняют в плохих намерениях, когда те отмечают, что интеллект обладает таким же генетическим компонентом, как и любое другое человеческое качество. Однако я все же убежден, что игнорировать эту тему – плохая идея. Лучшим противоядием от сомнительных выводов коварных людей являются хорошие люди, лучше владеющие темой. Выражусь иначе: ни за что нельзя доверять правду засранцам.

Особенно прекрасно это сформулировал философ Питер Сингер. Если вера в равные права для всех – и выступление против рассизма, сексизма и других форм дискриминации – строится на том, что между людьми нет биологических различий, тогда будет сложно понять, что делать, когда появляются однозначные доказательства существования этих различий. Имеет больше смысла выводить свои моральные принципы из таких непоколебимых принципов, как стремление к равным возможностям. Если исходить из того, что интеллект обладает сильным генетическим компонентом, придется признать, что существует бесчисленное множество потенциальных гениев, которые не могут решать мировые проблемы только потому, что родились не в той стране и заняты своими попытками не умереть от голода. Уровень IQ Эйнштейна определенно бил все рекорды. Однако он не разработал теорию относительности, пока из последних сил собирал зерна на вьетнамском рисовом поле. Если некоторые люди рождаются с задатками выдающихся умственных способностей, мы должны чувствовать ответственность за то, чтобы этот бриллиант не был потерян из-за плачевных обстоятельств, – где бы то ни было в мире.

 

Генетическая основа интеллекта

Английский язык настолько превосходит немецкий, что полным отказам от немецких терминов уже не удивляешься. Как, скажите, пожалуйста, подобающе перевести блестящие термины вроде «Walkie-Talkie»? «Переносная радиостанция – устройство для общения», или «handfunk-sprechgerät», звучит слишком коряво, а если вы скажете «laufi-sprechi», «бегунчик-говорунчик», сразу же можете пойти и запереться в комнате с Недом Фландерсом. И кого же посетила грандиозная идея назвать бабочек, самых нежных из существ, «schmetterlinge»? Кого, позвольте спросить, они отшметелили? Может, и без того потрепаное эго менее эстетичных летающих насекомых?

«Anlage-umwelt-kontroverse», что на русском звучало бы как «социогенетизм или биогенетизм», в английском также имеет более изящное название: «Nature versus nurture». Этот термин был придуман нашим старым другом Фрэнсисом Гальтоном. Речь идет о вопросе, в какой степени на качества личности влияет окружающая среда и насколько сильны генетические влияния. Затрудняет ответ на этот вопрос то, что зачастую невозможно провести четкую границу между окружающей средой и генетикой, потому что, например, окружающая среда может влиять на то, какие гены активируются, а какие находятся в состоянии покоя. Тем не менее можно встретить грубое различие. Никто не станет отрицать, что на цвет глаз гены влияют больше, чем, например, на страсть к коллекционированию марок. Размер тела также имеет очевидный генетический компонент, но на него может сильно повлиять недоедание в детстве. Едва ли найдется черта человека, во влиянии на которую окружающей среды и предрасположенности в разной степени можно сомневаться. Но когда дело доходит до интеллекта, генетический аспект вне исследований охотно игнорируется или даже отрицается. При этом можно достаточно точно оценить, какой процент различий в IQ у людей сводится к генам. И для этого даже не нужно знать, какие гены ответственны за это. Все, что для этого нужно, это простая математическая формула и очень много близнецов, готовых пройти тест IQ.

Даже ученым порой неприятно признавать, что интеллект отчасти определяют гены. Что об интеллекте нам поведают близнецы

Вероятно, вам известно, что существует два вида близнецов – однояйцевые близнецы (ОБ) и двуяйцевые близнецы (ДБ). Из этого можно предположить, что жизнь однояйцевых близнецов почти не отличается от жизни двуяйцевых. Они одновременно приходят в мир, имеют тех же родителей, живут в одном доме и чаще всего едят на обед одно и то же. Поэтому воздействие окружающей среды на ОБ и ДБ настолько идентично, насколько это только возможно. На генетическом же уровне эти типы братьев и сестер сильно различаются. Геном ОБ совпадает приблизительно на 100 %, тогда как у ДБ только на 50 %. Для исследователей это настоящая находка. Посредством изучения близнецов они могут исследовать степень, в которой различная форма выраженности черт – всех поддающихся измерению черт, включая интеллект, – у людей может быть объяснена с точки зрения генетики.

Геном однояйцевых близнецов практически идентичен, различия менее 1%.

Это работает следующим образом. Проведите IQ-тест среди большого количества близнецов. Затем сравните их результаты. Вы обнаружите, что ОБ, которые генетически идентичны, получат более схожие результаты, чем ДБ, которые разделяют только 50 % генома.

Опираясь на то, что условия окружающей среды для близнецов в значительной степени идентичны, вы можете рассчитать, какая часть этих разных результатов тестов идет на счет генов. И все это при помощи элегантной формулы. Пожалуйста, забудьте о E = mc2, этим сегодня вы уже никого не впечатлите. И потом, когда вас спросят, что это вообще означает, все равно будет неловко. Я дам вам формулу, с которой вы произведете гораздо больший эффект и которая будет полезной, если вы всегда хотели подразнить близнецов, – это формула Фальконера:

h2 = 2 (rОБ – rДБ),

h2 – здесь наследование, от английского heritability;

rОБ – это корреляция результатов теста IQ между однояйцевыми братьями и сестрами, когда каждый человек сравнивается со своим близнецом. (Повторюсь: если бы все однояйцевые братья и сестры достигли абсолютно одинаковых результатов со своим близнецом, r был бы равен 1).

rДБ – это корреляция результатов теста IQ между двуяйцевыми близнецами.

Уже на момент ознакомления с формулой вы заметите, что результаты теста генетически идентичных ОБ намного более похожи, чем результаты генетически разных ДБ. Давайте примерно подсчитаем. У ОБ корреляция будет примерно rEZ = 0,85. Это чертовски близко к 1. Фактически результаты теста ОБ примерно такие, как если бы один и тот же человек сделал тест дважды. Если сравнить результаты ДБ, корреляция rДБ = 0,60 значительно слабее. Используя формулу, рассчитайте разницу между этими двумя значениями и умножьте на 2, потому что генетическое сходство ОБ в два раза больше, чем ОБ. В этом случае значение наследования будет: h2 = 0,5. Но что это значит? Наследование от 0,5 в этом случае означает, что различные показатели IQ у людей на 50 % объясняются их генами. Это НЕ означает, что интеллект одного человека на 50 % генетически обусловлен! Здесь нужно быть очень внимательным. Этот метод можно применять также для проверки генетического воздействия на индекс массы тела, и значение наследования будет приблизительно таким: h2 = 0,7. Это означает, что 70 % различий ИМТ в населении могут быть объяснены генетическими различиями, но не то, что вы, как отдельно взятый человек, несете ответственность только за 30 % своих запасов на животе и ягодицах. Не надо жалких оправданий, все дело в ужинах с кордон блю.

В случае с интеллектом наследование в 50 % является довольно распространенным средним значением, но есть одна вещь, которую нужно учитывать, – возраст. С возрастом растет не только страсть к кроссвордам, но и влияние наших генов на интеллект. Наследственность у детей составляет всего около 20 %, тогда как различие уровней интеллекта среди взрослых примерно на 80 % объясняется генетикой.

Факт неочевидный, но он не так противоречив, как кажется на первый взгляд. То, что генетическая доля наследственности увеличивается с годами, может иметь разные причины. Одна из них состоит в том, что многие гены, связанные с интеллектом, становятся активными только в более позднем возрасте. Не все наши гены считываются постоянно. Некоторые работают только тогда, когда мы еще на стадии зародышей, другие – в пубертатный период, третьи – лишь в пожилом возрасте. Может случиться так, что наследственность интеллекта увеличивается с возрастом просто потому, что все больше и больше вовлеченных генов начинают выполнять свою функцию. С другой стороны, это также может быть связано с тем, что в течение нашей жизни мы склонны приспосабливать к себе окружающую среду так, чтобы она лучше соответствовала нашим генетическим предрасположенностям. Например, когда люди с превосходным пространственным мышлением стремятся стать архитекторами, а люди, обладающие склонностью к великолепному пониманию речи, зачастую работают переводчиками. В результате влияния генетики и окружающей среды с увеличением возраста будут все больше «сливаться» с возрастом, как если бы наши гены подталкивали нас в направлении, в котором они смогут наилучшим образом реализовать свой потенциал.

Влияние генов на интеллект увеличивается с возрастом.

 

Исследование усыновления, удочерения и генетики

То, что наследственность интеллекта составляет до 80%, убедительно доказывают многочисленные исследования близнецов. Однако этот тип исследований довольно спорный. Он основан на предположении, что с ОБ и ДБ обращались по большей части одинаково. Но это только предположение, что, например, родители чаще одевают генетически идентичных ОБ в одинаковую одежду, потому что, по-видимому, считают это милым. Кроме того, ОБ, в среднем, проводят больше времени вместе, чем ДБ. Может ли это быть одной из причин, почему ОБ достигают более схожих результатов в тестах на уровень интеллекта? Не исключено, но для проверки наследственности черт есть еще и другие методы, которые обходятся без близнецов. Можно, например, сравнить IQ усыновленных детей и их биологических родителей и усыновителей. Такое сравнение показывает, что значения IQ детей гораздо больше зависят от интеллекта их биологических родителей, чем от IQ усыновителей – даже если с момента рождения дети никогда не контактировали со своими биологическими родителями. Эта взаимосвязь также усиливается с возрастом детей. Поэтому показатели IQ людей зависят меньше от того, кто их воспитывает, чем от того, кто их рожает.

Однояйцевые близнецы в среднем проводят больше времени вместе, чем разнояйцевые.

Те, кто считает исследования родителей и детей устаревшими, могут воспользоваться более новой технологией, называемой GCTA (Genome-wide Complex Trait Analysis), которая оценивает наследование свойства непосредственно по ДНК большой группы людей. В широком масштабе сравнивается, связаны ли сходства в ДНК человека с аналогичными результатами теста IQ. Для этого также не нужно знать, какие гены ответственны за интеллект. Каждый из этих методов исследования имеет свои преимущества и недостатки. Однако не имеет значения, какой из них будет избран, кажется, все они – исследования близнецов, усыновления или GCTA – приведут к одному результату: то, насколько разными будут результаты людей в тесте на уровень интеллекта, в значительной степени обусловлено генетикой. И чем старше вы становитесь, тем сильнее проявляется эта взаимосвязь.

 

Интеллект и равенство возможностей

Многие находят идею о том, что интеллект имеет ярко выраженные признаки наследования, довольно дерьмовой. Хотя исследования уже давно единогласны относительно этой темы, 20–30 лет назад о генетических влияниях на интеллект ничего не хотели слышать и в сфере психологии. Среди населения эта позиция сохраняет свою силу и сегодня. Это понятно, ведь кажется несправедливым, что некоторые люди рождаются с более высокими шансами на мощный интеллект, чем другие. Тоже верно! Точно так же несправедливо, что некоторые люди появляются на свет с безупречным голливудским лицом, в то время как лица других настолько обрюзглые, что в лучшем случае могут играть в «Титанике», исполняя роль айсберга. Биология несправедлива.

Но именно в отношении темы интеллекта мы на самом деле должны быть счастливы, если проявляются максимально возможные показатели наследственности. Потому что они могут быть признаком того, что это действительно происходит в отдельно взятом обществе. Чтобы понять это, давайте вспомним, что на самом деле означает наследственность. Она описывает, в какой степени различия между людьми могут быть объяснены их генами. Следовательно, вывод от противного: она неизбежно описывает, в какой степени различия между людьми могут быть объяснены их окружающей средой. Если люди растут в очень разных условиях, окружение будет оказывать большее влияние на их различие в уровне интеллекта, чем если бы они все выросли в равных условиях. Поэтому различия в окружающей среде влияют на наследственность. Представьте себе гипотетический мир, в котором каждый человек растет в одной и той же среде. Каждый ребенок будет получать одинаково хорошую поддержку, доступ к одинаковой медицинской помощи, все люди будут наслаждаться одними и теми же возможностями во всех отношениях и будут одинаково воспитаны. От такого мира можно ожидать чрезвычайно высокого показателя степени наследования интеллекта. Несмотря на то что все по-прежнему получали бы разные результаты теста IQ, эти различия можно полностью списать на гены, поскольку среда идентична. Таким образом, наследование интеллекта внутри группы населения показывает, насколько равноценно происходит вырастание людей в этом обществе.

Это также отражено в данных, полученных в реальном мире. В странах со слабо развитыми социальными системами, где существуют значительные социальные различия, семьи из высших слоев общества имеют более высокий уровень наследственности, чем семьи из более низких слоев. Это может быть связано с тем, что представители высшего социального класса могут создать относительно равнозначные условия в своей среде, в то время как в низких социальных классах обстоятельства, в которых люди растут, различаются сильнее. Однако этот эффект наблюдается не в таких регионах, как Западная Европа, где существуют хорошо развитые социальные системы и все слои общества имеют одинаковый доступ к образованию и здравоохранению. Чем приличнее общество, тем более высокие показатели ожидаются от наследственного компонента интеллекта. Это индикатор равенства возможностей. Поэтому давайте радоваться каждому процентному пункту наследования интеллекта.

 

А не слишком ли мы глупы для поиска генов интеллекта?

Исследователи уже давно прилагают огромные усилия, чтобы раскрыть тайну генетической основы интеллекта. «Наиболее широкомасштабные последствия для науки и, возможно, даже для общества будут связаны с идентификацией генов, ответственных за наследование g-фактора», – написал в 1999 году Роберт Пломин, один из самых выдающихся американских исследователей-близнецов. За последние несколько десятилетий было идентифицировано множество вариантов возможных генов интеллекта с такими названиями, как KLOTHO и SNAP25. Была только одна крошечная проблема: все догадки оказались ошибочными.

Когда результаты были проверены с помощью более крупных исследований и новых методов последних 10 лет, обнаружилось, что открытые отдельные варианты генов не оказывали существенного влияния на интеллект. Это был суровый урок для исследователей того времени, и вполне вероятно, что многие из них в панике сделали сразу несколько тестов IQ, чтобы снова почувствовать себя умными.

Но исследования показали кое-что важное: интеллект является полигенным. Это означает, что на него существенное влияние оказывают не несколько генов, а огромное количество отдельных вариантов генов, каждый из которых вносит лишь крошечный вклад в наследование.

Кажется, что нет никаких выдающихся «генов интеллекта», – вместо этого генетическая доля представляет собой сумму, возможно, тысяч вариантов генов, хаотично разбросанных по всему геному.

До недавнего времени попытки найти ответственные гены не увенчались большим успехом. Одной из причин является то, что генные анализы до сих пор были дорогостоящими, и поэтому проводилось мало исследований, которые были бы достаточно крупными, чтобы обнаружить небольшие эффекты каждой области гена. Но благодаря быстрому снижению затрат на секвенирование ДНК и росту вычислительных мощностей компьютера, в последние годы исследователи все ближе и ближе подходят к этой цели благодаря так называемому полногеномному поиску ассоциаций (англ. genome-wide association studies GWAS). При этом измеряется IQ тысяч людей, также дополнительно у них берут образцы ДНК, чтобы проверить, связаны ли определенные показатели IQ с повышенным количеством определенных вариантов генов. Если быть более точным, исследователи ищут так называемые однонуклеотидные полиморфизмы (SNPs – произносится как «снип»). Это отдельные буквы ДНК, которые часто различаются у людей. Чтобы найти что-либо с помощью этого метода, нужно огромное количество участников испытаний. В самом широкомасштабном на сегодняшний день GWAS, который состоялся в 2017 году, сравнивали показатели IQ более чем 78 000 человек с их геномами. Это почти такой же большой набор данных, как если бы тест на уровень интеллекта провели среди половины населения венского района Фаворитен. Хотя, возможно, не следует чрезмерно приоритизировать венские муниципальные районы в поисках генов интеллекта. Всего исследователи обнаружили 336 SNPs, которые связаны с повышенным уровнем интеллекта. Они были в 22 генах, некоторые из которых ранее связывались с развитием мозга. Чтобы проверить, являются ли результаты действительно значимыми, исследователи использовали образцы ДНК 200 000 человек, чтобы выяснить, связаны ли эти 336 SNPs с различными жизненными событиями, и обнаружили сильную корреляцию (r = 0,7) между наличием SNPs и достигнутым уровнем образования. Кроме того, была выявлена также небольшая корреляция между объемом внутренней части черепа, окружностью головы в детстве и вероятностью не стать курильщиком. Какими бы впечатляющими ни были полученные результаты, они лишь плавают на поверхности генетической основы интеллекта. В целом, эти SNPs могут объяснить только 5% различий интеллекта между людьми. Поэтому мы знаем, что должно быть еще много других генетических факторов влияния, которые не были выявлены в ходе исследования.

Поэтому анализ ДНК для прогнозирования интеллекта будет оставаться скорее малозначимым до тех пор, пока мы не станем лучше понимать генетическую основу. Наиболее точный прогноз интеллекта с использованием образцов ДНК удалось сделать в 2018 году. Тогда было спрогнозировано 4–7 % измеренных различий в уровне интеллекта между людьми на основе их генов. Это хорошее начало, хотя и слишком маленькое и неточное, чтобы иметь какое-либо практическое применение. Однако систематический поиск генетической основы интеллекта действительно набрал обороты в последние годы. И чем больше людей, проходящих тест IQ и готовых изобличить свой геном, тем больше этих факторов влияния смогут идентифицировать исследователи.

Я не сомневаюсь, что через 10 лет мы будем знать о генетической основе интеллекта определенно больше, чем сегодня. Вопрос в том, что нам с этим делать. После того, как мы определили большое количество вариантов генов, связанных с интеллектом, было бы легко выбрать в ходе искусственного оплодотворения эмбрионы, которым дали бы наилучшие условия для развития высокого интеллекта и связанного с ним жизненного успеха. Особенно заманчивым это было бы для таких стран, как Китай, где серьезно относятся к успеваемости лишь очень немногих детей, считая соображения этики не более чем ментальными декоративными строчками. С другой стороны, целенаправленное влияние на интеллект с помощью CRISPR, вероятно, будет затруднительным, поскольку в настоящее время невозможно вызвать сотни изменений генов одновременно. Однако не исключено, что, вероятно, определенная комбинация нескольких вариантов гена уже может оказать большое влияние на интеллект. Это также выяснится только в ближайшие годы.

Но, возможно, нет необходимости напрямую изменять все вовлеченные гены, чтобы влиять на биологическую основу интеллекта.

Хотя идентифицируется все больше и больше областей генов, связанных с интеллектом, мы до сих пор понятия не имеем, как они работают вместе.

Может оказаться, что многие из этих генов активны в паре с нейробиологической системой. Иначе говоря, многие гены могут принадлежать к одному и тому же нейробиологическому сигнальному пути. Если бы это было так, для оптимизации необязательно было бы изменять все вовлеченные гены – целью стало бы прямое воздействие на сигнальный путь. Поэтому необязательно начинать с генов, чтобы иметь возможность влиять на биологическую основу интеллекта. Тем временем исследуются несколько методов, которые нацелены именно на это. Некоторые из них концентрируются на консервативном глотании таблеток. Другие работают с простыми, но часто опровергаемыми поведенческими советами, а третьи экспериментируют с кажущимися футуристическими, но в действительности многообещающими вмешательствами при помощи магнитных полей и импульсов тока.

 

Как стать менее глупым?

Прежде чем мы продолжим углубляться в вопрос о том, как повышается уровень интеллекта (и как понижается), мы должны подумать о том, хотим ли мы этого вообще. Конечно, IQ коррелирует со здоровьем, доходом, социальным статусом и другими приятными вещами. Но если мы чему-то и научились у Netflix, так это тому, что типы вроде Шелдона Купера, хотя и невероятно хороши в решении интегральных уравнений, в общении с дамами проявляют такую же ловкость, как и инвалид в волейболе. Есть ли доля правды в клише, что высокий интеллект приобретается за счет социальных навыков? Как знать. Вопреки распространенным предубеждениям, интеллект не коррелирует с тем, насколько кто-то покладист или экстравертирован. Проблематичным это становится только тогда, когда вы впадаете в обе крайности и хотите быть одновременно интеллектуальным сверхчеловеком и общепризнанной секс-машиной. Кажется, есть интеллектуальная золотая середина, которая воздействует особенно притягательно.

 

Интеллект делает сексуальным?

Людей, которых привлекает чрезвычайно высокий интеллект, обычно называют сапиосексуалами (sapere в переводе с латинского означает «знать» или «быть умным»). Ко скольким людям это применимо, попытались выяснить в исследовании, появившемся в 2018 году. Испытуемые должны были отвечать на вопросы, ориентируясь на шкалу от «крайне непривлекательный» до «чрезвычайно привлекательный». Например: «Насколько вас бы заинтересовал партнер, если вы узнаете, что его / ее интеллект выше, чем у 75 % населения, 90 % населения, 99 % населения и т. д.?»

Оказалось, что уровень интеллекта, которым обладает человек, относящийся к 10 % умнейшим среди населения, является наиболее привлекательным. Этот показатель IQ начинается от 120.

Однако если человек причислен к 1 % умнейших, он оценивается как менее привлекательный. Здесь значение IQ начинается от 135. То есть партнер может быть умным, но не слишком умным. Возможно, причина этого аналогична часто звучащему суждению: «Я хочу партнера, который подкачан, но не настолько, чтобы я на его фоне выглядел(а) толстым(-ой)». Возможно, дело еще и в том, что текстовые анкеты не являются оптимальным средством оценки привлекательности. Но было измерено кое-что еще, что позволило сделать более надежное утверждение. Участники исследования должны были сами сделать тест на уровень интеллекта. Это показало, что фактический интеллект человека не влияет на то, насколько он ощущает себя сапиосексуалом. То, что вы считаете особенно высокий уровень интеллекта притягателным, не имеет отношения к тому, обладаете ли вы IQ Эйнштейна или картофеля.

Неудивительно, что интеллект играет ключевую роль при выборе партнера, учитывая более широкие возможности при выборе работы, бо́льшие шансы на высокий доход и связанные с этим ресурсы для совместного планирования жизни. В целом, число женщин, которые чувствовали влечение к высокому IQ, было немного больше, чем мужчин. Причины этого могут быть обусловлены эволюцией. Специалист по эволюционной психологии Джеффри Миллер в одном из исследований показал, что показатели IQ мужчин коррелируют с качеством их спермы. Корреляция была слабой, но тенденция проявилась таким образом, что сперма у мужчин с высоким IQ не только более концентрированна, но и более подвижна. Поэтому Миллер выдвинул тезис, что высокий интеллект у мужчины может сигнализировать женщинам о его хороших генах. Это довольно спекулятивно, но давайте попробуем. В следующий раз, когда вы пригласите даму в бар, швырните на стойку бумагу и карандаш и решите матричное уравнение, шепча ей на ухо с озорной улыбкой: «Лучшее семя в городе, детка».

Показатели IQ мужчин коррелируют с качеством их спермы.

Арне Калке, бывший руководитель Parship и Elitepartner, считает, что женщины при выборе партнера придают большее значение образованию партнера, чем мужчины, и это могло бы стать проблемой. По его словам, ресурс «образованный мужчина» постепенно становится дефицитным на платформах для знакомств, потому что уже на протяжении десяти лет выпускниц университетов больше, чем выпускников, но образованные женщины, как правило, стремятся к партнерам, которые были бы такими же образованными, как они сами, или более. Если вы мужчина и возможность получения лучшей работы для вас недостаточно сильная мотивация, чтобы начать готовиться к экзамену, то воспринимайте это как увеличение шанса переиграть Тиндер.

Кроме того, образование – один из факторов, которые могут увеличивать значение IQ в долгосрочной перспективе. «Отлично, – подумали вы сейчас, – я заплатил за книгу, чтобы узнать, что школа делает умным. Я уже проверял это с помощью “Шоу с мышкой”». Однако не так уж это и очевидно! Хотя уже давно известно, что люди, которые длительное время занимаются своим образованием, имеют более высокий IQ, до недавнего времени не было известно почему. Для этого могут быть две причины: возможно, люди, которые с рождения обладают высоким IQ, дольше занимаются своим образованием, потому что оно дается им легче, чем другим. Тем не менее может быть и так, что обучение напрямую увеличивает показатель IQ. Только в 2018 году большой мета-анализ доказал, что дополнительное образование действительно увеличивает IQ, а именно на 1–5 баллов IQ за год обучения. Ни один серьезный ученый не утверждает, что интеллект исходит исключительно от генов. Обучение, несомненно, является проверенным, незаменимым фактором, который, однако, в то же время исключительно дорогостоящ и требует большого количества времени. Исследования долгое время искали способы повысить интеллект человека с помощью более простых методов, чем просиживание штанов на школьной скамье. Полноценное использование потенциала мозга или даже выход за его пределы считается Святым Граалем исследований интеллекта.

Дополнительное образование увеличивает IQ на 1–5 баллов за год обучения.

 

Как не повысить интеллект

Определенно, вы уже слышали о том, что люди используют свой мозг только на 10%. Запомните, как железное правило, что это относится только к тем, кто утверждает, что мы используем только 10% нашего мозга. Все остальные используют весь орган. Никто точно не знает, откуда появился этот миф, но он лишь один из многих, прилепившихся к теме интеллекта.

Исследование, вышедшее в 1998 году, показало, что люди лучше справляются с викторинами, если их предварительно склоняют к мыслям о профессорах, чем когда они думают о футбольных хулиганах.

Исследование не выявило, что происходит, когда кто-то думает о профессорах, которые после лекции дерутся с полукоматозными фанатами венского «Рапида». Правда, это вообще не имело бы никакого значения, потому что многочисленные исследования, которые пытались доказать эффект, провалились в этом. Фэйковые новости существуют уже долгое время, даже задолго до того, как американские президенты стали настолько любезны, чтобы регулярно сообщать нам об этом в Твиттере.

Однако в науке исследования, приводящие к ложным результатам, редко являются преднамеренным обманом. В большинстве случаев речь идет о чрезмерно популяризированных промежуточных результатах методически слабых исследований в сложных исследовательских полях. Поэтому было бы важно скептически относиться к предполагаемым прорывам в исследованиях интеллекта, пока независимые ученые не смогут повторить результаты. Однако это может занять годы, а у журналистов, которые полагаются на клики и счастливы, если им вообще платят, не так много времени. Это приводит к тому, что кажущиеся сенсационными открытия расходятся с бешеной скоростью и остаются в головах людей, даже если десять лет спустя выясняется, что стажер лаборатории с похмелья перепутал данные.

В 1998 году американский политик Зелл Миллер сделал бюджетную заявку, которая предусматривала дарение каждому новорожденному ребенку в штате Джорджия музыкальной кассеты при выписке из больницы. Это был не самый горячий микстейп политика, а музыка Вольфганга Амадея Моцарта. Миллер держал в голове не банальную любовь к классической музыке (хотя во время его обращения звучала «Ода к радости» Бетховена), а исследование, опубликованное пятью годами ранее в Nature, одном из самых авторитетных научных журналов. Ученые предлагали участникам исследования выполнить тесты на уровень интеллекта после того, как они спокойно сидели в течение десяти минут, выполняли упражнение на расслабление или наслаждались «Сонатой для двух фортепиано ре мажор» Моцарта. Группа с Моцартом справилась с тестами, касающимися пространственного мышления, на 8–9 IQ-баллов лучше, чем при выполнении других задач. Однако эффект длился всего 10–15 минут. В СМИ это было преподнесено примерно так: «Музыка Моцарта повышает интеллект на 8–9 баллов IQ», – не беря во внимание, что улучшилось только пространственное мышление и что через 15 минут люди становились такими же глупыми, как и раньше. Именно благодаря этому исследованию вы можете приобрести на Amazon различные диски из серии «Моцарт для мозга – буст твоего IQ». И это несмотря на то, что мнимый «эффект Моцарта» фактически разнесли в пух и прах в обзорной работе 2010 года. Около 40 последующих исследований с участием более 3000 испытуемых не смогли его воспроизвести. Но до этого момента идея о том, что прослушивание классической музыки повышает интеллект, 17 лет распространялась со скоростью звука.

Если вы установите звуковую систему на 5000 ватт в каждом университетском лекционном зале, чтобы вливать Моцарта в ушные раковины студентов, вырастут счета за электроэнергию и стоимость акций производителей аспирина, но уж точно не успеваемость. Эти отрезвляющие результаты свидетельствуют о том, что мы должны отказаться от идеи улучшения интеллекта с помощью простых трюков. Тем не менее, помимо воспитания, образования и генетики, существуют и другие факторы влияния, воздействующие на наш интеллект. И половина мира с 1930-х годов случайно приняла участие в эксперименте, изучающем влияние на IQ.

 

Свинец отупляет?

Когда в Первую мировую войну обнаружилась прекрасная возможность сбрасывать бомбы на головы врагов из самолета, спрос на высококачественное топливо возрос. Вскоре после окончания войны в General Motors выяснили, что тетраэтилсвинец (ТЭС), относительно простое соединение свинца, может быть использован для предотвращения неконтролируемого самовоспламенения бензина в цилиндрах. Таким образом, ТЭС превратился в добавку к широко используемому антидетонационному средству для бензина и авиационного топлива. В результате снизился уровень шума двигателей вместе с IQ и миролюбием людей. По крайней мере, многочисленные исследования подтверждают этот вывод.

Уже в первые годы производства ТЭС производственные объекты получили прозвище «Безумный бензиновый завод», потому что сотрудники стали вести себя крайне странно. В итоге более половины работников оказались в госпитале, где многие из них умерли.

Проблема заключалась в том, что ТЭС – это нейротоксин, который проникает через кожу в организм, накапливается в нем и вызывает у рабочих беспощадное отравление свинцом.

Несмотря на это, ТЭС оставался обычной топливной добавкой на протяжении многих десятилетий, и концентрация свинца в крови населения неуклонно росла до 1970 года. Только тогда большая часть мира начала постепенно выводить свинец из использования, что снизило его содержание в крови у американских детей с примерно 25 микрограммов на децилитр до менее чем 5 микрограммов. Вместе с уровнем содержания свинца упал и уровень преступности. С 1960 года количество преступлений в США практически неотступно следует за количеством свинца в крови маленьких детей, правда, с задержкой примерно на 20 лет. Потому что тогда дети доходят до возраста, когда могут выпускать пар преступными деяниями. Считается, что эффект мог оставаться незамеченным так долго из-за этой задержки. Даже количество последующих тюремных заключений может быть определено по исследованию уровня свинца в крови в детстве.

Но, кажется, не только уровень преступности находился под влиянием свинца. Чем выше были показатели уровня свинца у детей, тем ниже они были у взрослых в тестах на IQ и тем ниже был их социальный статус. Исследование, проведенное в 2014 году, показывает, что усилия по сокращению содержания свинца с 1970-х годов повысили средний IQ взрослого населения США примерно на 4,5 балла. Связь между свинцовыми добавками в топливе, IQ и преступностью была продемонстрирована не только в США, но и в отдаленных регионах, таких как Новая Зеландия, и, возможно, была бы установлена во всех странах, где в бензине присутствовали свинцовые добавки, если были бы проведены соответствующие исследования.

В регионах, где проживает много аистов, рождается больше детей.

Конечно, с такими заявлениями следует быть осторожными. Только то, что два показателя коррелируют друг с другом, к примеру, количество свинца и криминалитет, необязательно должно означать, что одно – причина другого. В качестве примера статистики любят упоминать тот факт, что в областях, где проживает много аистов, рождается больше детей. Это доказывает, что аист приносит детей? Должен вас разочаровать. Не так просто скинуть ответственность за нежелательную беременность. Но это показывает, что существуют псевдокорреляции, когда один показатель якобы влияет на другой. В случае с аистами корреляция обусловлена тем фактом, что в сельских районах наблюдаются как более высокие показатели рождаемости, так и более благоприятные условия жизни для аиста. Таким образом, «сельская местность» является скрытой фоновой переменной, которая соотносит «аистов» и «детей», хотя они не имеют прямого отношения друг к другу. Могут ли такие неизвестные фоновые переменные также отвечать за корреляцию между показателями содержания свинца и интеллектом? Этот вариант трудно исключить. Но хотя корреляция необязательно означает, что две вещи напрямую связаны, она часто является надежным признаком этого. Особенно, если эффект очевиден во многих регионах мира и существует убедительный механизм действия, который предполагает такую связь.

 

По ту сторону генов и образования

Конечно, под оптимизацией большинство людей понимает нечто иное, чем увеличение преступности и снижение показателей IQ целых земель. Тем не менее, чтобы улучшить интеллект, нужно знать, что его ухудшает.

На самом деле все же могут быть способы позитивно влиять на интеллект потомства еще в утробе матери. И, как и во многих сферах жизни, крысы – впереди планеты всей. Многочисленные исследования проверяли эффективность введения беременным крысам высоких доз холина, соединения аммония, в качестве пищевой добавки. В организме холин превращается в нейромедиатор ацетилхолин, который необходим, среди прочего, для коммуникации между нервными клетками. Если дать беременным крысам дополнительную дозу этого вещества в количестве, которое выходит за рамки естественного, в некоторых испытаниях их потомство будет показывать лучшие результаты, чем без пищевых добавок. Холин изменяет пластичность гиппокампа, область мозга в форме морского конька, и взрослый потомок грызунов, накачанный холином, обладает улучшенной пространственной и временной памятью. В результате, помимо прочего, крысы лучше справляются с лабиринтами. Если бы ваша мама предпочла во время беременности холин диску Моцарта, вы, возможно, реже сбивались бы с пути по дороге домой из пивной. Однако мы этого не знаем, потому что, достигают ли высокие дозы холина при беременности аналогичных эффектов у людей, изучено не так хорошо, как в случае с крысами.

Хотя есть исследования, которые обнаруживают связь между рационом, богатым холином во время беременности, и улучшением умственных способностей детей, но они настолько незначительны, что не следует делать никаких преувеличенных выводов.

Правда, за пределами лабораторий соответствующий эксперимент проходит незамеченным, поскольку холин в Европе довольно малоизвестен, а вот в США в качестве пищевой добавки распространен широко и рекламируется, в частности беременным женщинам.

Но, похоже, не только то, что происходит до рождения, влияет на умственные способности человека, но и то, что происходит во время него. Согласно крупному австралийскому исследованию дети младшего школьного возраста, родившиеся с помощью кесарева сечения, считают, читают и пишут несколько хуже, чем одноклассники, которых обычным путем выдавили из родового канала. Вывод не меняется, если соучесть такие факторы, как степень образованности родителей и здоровье мамочки. Причиной этого, согласно предположениям исследователей, являются бактерии в родовом канале матери. Пока ребенок проходит мимо одноклеточных организмов во время вагинальных родов, они могут спокойно заселить организм малыша. В результате кишечная флора ребенка, родившегося естественным путем, развивается иначе, чем после кесарева сечения. Из предыдущих исследований известно, что кишечные бактерии могут влиять на развитие нервной системы и, следовательно, мозга.

Есть даже доказательства того, что не только тип родов влияет на успеваемость, но и очередность. Исследователи давно предполагали, что в тестах на IQ первенцы показывают себя лучше, чем дети, родившиеся позже. Большое немецкое исследование подтвердило это предположение в 2015 году с помощью показателей IQ тысяч людей. Дети, рожденные первыми, в тестах на уровень интеллекта показали лучшие результаты, чем родившиеся вторыми, которые, в свою очередь, оказались лучше, чем третьи, и так далее. И никто не знает почему. Причины могут быть биологическими, но это также может быть связано и с тем, что родители при рождении каждого последующего ребенка могут уделять меньше внимания каждому ребенку по отдельности. Однако прежде чем вы побежите к своему младшему брату, чтобы ткнуть его носом в его же научно доказанную неполноценность, подумайте о следующем: причина, по которой для доказательства эффекта потребовались тысячи людей, заключается в том, что он очень-очень маленький. В среднем первенцы справляются лучше примерно на 1,5 балла IQ, чем их братья и сестры, родившиеся после. Примерно в 60 % случаев оказывалось, что первенцы в семье имеют более высокий IQ. В качестве заключения от противного это означает, что в 40 % случаев все наоборот. Такие эффекты могут быть измерены на основе больших групп людей, но на индивидуальном уровне они вряд ли будут значимы. Очередность рождения имеет мало значения для человека. Это, по собственному глубокому убеждению, утверждаю я, младший брат старшей сестры.

Кишечные бактерии могут влиять на развитие нервной системы и самого мозга.

То же самое относится и к другим влияющим факторам, упомянутым ранее. Предположительно, существует множество вещей, которые могут повлиять на IQ, помимо образования и генетики. Независимо от того, сыпала ли ваша беременная мама каждое утро килограмм холина в мюсли, были вы первым или десятым ребенком, выскользнули вы из утробы с кесаревым сечением или без него, приехали ли вы из одной из последних трех стран, которые щедро накачивают свинцом баки. Каждый из этих факторов в отдельности едва ли имеет значение на индивидуальном уровне.

 

Эффект Флинна

Но даже если отдельные факторы, влияющие на интеллект, кажутся очень сложными в деталях, в результате мы, вероятно, на правильном пути. С тех пор, как стали проводиться тестирования уровня интеллекта, показатели IQ по всему миру росли примерно на 3 балла за десятилетие. Таким образом, в период с 1909-го по 2013 год средний IQ вырос на целых 30 баллов, как показал мета-анализ, который был направлен на изучение развития интеллекта в более чем 30 странах. Это непрерывное повышение IQ называется эффектом Флинна, в честь политолога Джеймса Р. Флинна, который впервые продемонстрировал это явление в 1987 году.

Никто не может уверенно ответить, почему интеллект растет от поколения к поколению. Без сомнения, свою роль играют хорошее питание и здравоохранение, а также тот факт, что больше людей, чем когда-либо прежде, имеют доступ к образованию. Но, по словам Флинна и других ученых, этого недостаточно, чтобы объяснить такой стремительный рост. Флинн предполагает, что одной из причин является то, что наш образ мышления радикально изменился за последние 100 лет. В то время как мышление людей в начале XX века было очень практичным и ориентированным на действия, сегодня значительной частью нашей повседневной жизни является абстрактное мышление.

Флинн ссылается, в том числе, на русского психолога Александра Лурию, который проводил многочисленные психологические тесты среди населения в конце XIX и начале XX веков. Как бы вы, например, ответили на следующий вопрос: «Что общего между лошадью и собакой?» Сто лет назад типичным ответом было бы: «Оба животных нужны для охоты». Крайне практичное утверждение, которое относится к собственному опыту. Сегодня на этот вопрос скорее ответят: «Оба животных являются млекопитающими». Абстрактное таксономическое утверждение безотносительно к каким-либо действиям. «Сегодня мы все носим научные очки», – сказал как-то Флинн. Позиция, которой Флинн до сих пор придерживается, несмотря на отрицающих климатические изменения и существование «Общества плоской земли» с растущим числом членов.

Также в качестве причины повышения интеллекта не исключаются и генетические факторы. Сто лет – это слишком мало, чтобы полноценно изменить такое сложное качество с помощью стандартного эволюционного арсенала мутации и селекции. Однако повышенная мобильность людей могла привести к так называемому эффекту гетерозиса. Он известен в основном благодаря растениеводству, когда из-за скрещивания различных генеалогических линий продуктивность потомства выше, чем средняя продуктивность родительского поколения. У людей дать аналогичный эффект могли бы набирающая темпы урбанизация и возникающая в результате смесь ранее обособленных друг от друга групп населения. Тем не менее научного консенсуса по этому вопросу не существует.

С 1909-го по 2013 год средний IQ людей вырос на целых 30 баллов.

«Так, подождите-ка, – думаете вы сейчас, – как можно продолжать увеличивать средний IQ, если показатели IQ складываются путем сравнения со средними показателями других людей?» Совершенно обоснованное возражение. После того как результаты тестов людей улучшаются каждые несколько лет, необходимо регулярно устанавливать новые «стандарты нормы», с которыми будут сравниваться актуальные результаты тестов. Это означает, что каждые несколько лет тысячи людей должны проходить тест на IQ, чтобы их средние значения можно было определить как новое среднее значение IQ от 100. Поэтому, если вы сегодня сдадите IQ-тест, ваши результаты будут сравниваться с последними стандартами нормы, чтобы вы знали, насколько хорошо вы справились по сравнению с вашими современниками. Предположим, что ваши результаты абсолютно средние и при сравнении с актуальными стандартами нормы вы получаете показатель IQ 100. Ранее мы говорили о том, что средний IQ растет примерно на 30 пунктов в течение 100 лет. Это означает, что если вы сравните результаты своего теста, которые дают значение IQ 100 в условиях текущих стандартов нормы со стандартами 1920 года, ваш IQ составит около 130. Это по определению соответствует одаренности. Если сделать наоборот и сравнить результаты теста среднего интеллектуала 1920 года с современными стандартами нормы, значение IQ будет равно 70, что в настоящее время считается границей ограниченной способности к обучению. Но теперь-то вы уже точно заметили, что далеко не только гениев бросает из стороны в сторону. Так что люди 100 лет назад не были тупы, как пни. Скорее, кажется, результаты тестирования интеллекта изменились только в некоторых областях, таких как визуальное и логическое мышление, в то время как другие, например, скорость обработки информации, как правило, остаются неизменными.

Особенно стремительно показатели интеллекта растут в развивающихся странах, где образование, здравоохранение и продовольственная безопасность достигли больших масштабов только в последние десятилетия. С другой стороны, есть признаки того, что IQ сейчас находится в состоянии стагнации или даже немного снижается в некоторых западных странах. Но этот вывод довольно спорный, и в настоящее время нельзя точно сказать, на чем базируется эта стагнация и действительно ли она есть.

Но независимо от того, перестал ли проявляться эффект Флинна в западных странах, ясно, что рост интеллекта когда-нибудь достигнет биологического предела. И многие из людей, которые зарабатывают свои деньги, будучи чрезвычайно умными, уже пытаются обойти эту проблему. Хотя и с помощью метода, который может решить все проблемы мира, по крайней мере, в краткосрочной перспективе: специальные препараты. В 2008 году профильный журнал Nature провел опрос среди ученых в 60 странах, чтобы выяснить, сколько из них глотают таблетки для повышения результативности. Опрос ограничился тремя наиболее широко используемыми «умными препаратами», также называемыми ноотропами, нейрометаболическими стимуляторами или доппинговыми таблетками для мозга. Речь идет о рецептурных лекарствах, которые, как говорят, повышают умственную работоспособность здоровых людей. Каждый пятый поучаствовавший в опросе ученый ответил, что уже глотал умные препараты с этой целью.

Но все больше и больше людей, особенно в последние несколько лет, обращают внимание на «умные препараты» за пределами исследований. Только с 2015-го по 2017 год в индустриально развитых странах число здоровых людей, которые принимают ноотропы для повышения продуктивности, почти утроилось – примерно с 5 до 14 %, причем нигде это возрастание не проявилось сильнее, чем в Европе.

Но могут ли таблетки на самом деле что-то сделать или все эти потребители просто жертвы, выдающие иллюзорное желаемое за действительное? В то время как умные препараты фактически были разработаны в качестве лекарств для лечения ментальных расстройств, существует не слишком много исследований, проверяющих их влияние на умственную работоспособность здоровых людей. А те, что существуют, были собраны в обширной обзорной работе в 2014 году. Далее последуют лучшие из них.

 

«Умные» препараты

Одним из самых распространенных «умных» препаратов, ноотропов, в Европе является риталин, который часто назначают для лечения синдрома дефицита внимания / гиперактивности (СДВГ). Пациентам с СДВГ он помогает сосредоточиться на задаче или мысли, не отвлекаясь ни на какие мыслимые мелочи. Но здоровые люди также ценят риталин за его повышающие концентрацию свойства. Активное вещество в нем называется метилфенидат. Если вы хотите запомнить это и вам нужна шпаргалка, пропойте «метилфенидат» на мотив испанской рождественской песни Feliz Navidad. Только постарайтесь не забыться в канун Рождества, когда вы и ваша семья благоговейно стоите перед украшенной рождественской елкой.

Торговое название «риталин» легче произносится и к тому же обладает милой предысторией.

Риталин был разработан в 1944 году итальянским химиком Леандро Паниццоном. Чтобы проверить изобретенное вещество, он не только сам проглотил его, но и попросил попробовать свою жену Риту.

Вы же знаете, как это бывает: едва мужчина начинает есть, женщина хочет попробовать еду из его тарелки. Рита была в восторге от того, насколько вещество улучшило ее показатели в теннисе. Старые добрые времена, когда жене еще разрешалось перекусить в лаборатории для увеличения группы контрольной пробы. Несомненно, это одна из причин, по которой уровень разводов был тогда так низок. Таблетки – это клей, который не позволяет хорошему браку развалиться. Исследования, проведенные со здоровыми людьми, показывают, что риталин улучшает продуктивность людей, когда те сталкиваются с новой постановкой задачи. Кроме того, они лучше справляются с решением задач, которые требуют повышенного внимания.

Именно этот эффект повышения концентрации делает риталин особенно популярным среди студентов-медиков, которым для своих ежегодных экзаменов приходится спрессовывать в мозге тонны, как правило, сухого материала.

Второй, особенно популярный в Европе ноотроп – это модафинил. Обычно препарат назначают для лечения нарколепсии. Больным он помогает своими ободряющими свойствами подавлять спонтанные приступы сна. У здоровых людей он также подавляет потребность в сне и уменьшает время реакции, улучшает логическое мышление и способность решать проблемы. Однако, вероятно, самое важное, что модафинил усиливает юмор в комиксах, но не в рассказанных шутках. Понятия не имею, каким образом это исследовалось. Вы в курсе?

Модафинил делает более смешным визуальный юмор, но никак – вербальный.

Длительный эффект энергичности от модафинила является причиной того, что он распространен не только среди студентов и работающих по сменам, но и среди военных. Многие страны снабжают своих летчиков-истребителей в длительных боевых наступлениях модафинилом, чтобы они могли оставаться бодрыми и сконцентрованными. Но именно такие обстоятельства применения поддерживающих продуктивность таблеток затрудняют их классификацию с точки зрения этики. С одной стороны, никто не хочет, чтобы над его головой парили летчики-истребители, накачанные различными лекарствами. С другой стороны, они могут совершать меньше ошибок, чем их совершенно измотанные коллеги. А что, если летчики-истребители работают лучше под влиянием модафинила, и бомбы с меньшей вероятностью поражают мирных жителей? Разве не следует дать им возможность использовать эту опцию? Возможно, в случае с летчиками-истребителями нужно даже в обязательном порядке поить их модафинилом? А как насчет других ответственных задач, где усталость часто приводит к катастрофам, как, например, в хирургии? Нужно ли разрешать хирургам употреблять его, если окажется, что под ножом будет умирать меньше пациентов? Как насчет ученых, исследующих рак? Можем ли мы быстрее разработать терапию, если увеличим их продуктивность на несколько процентов с помощью модафинила?

Помимо риталина и модафинила есть много других веществ, которые часто называют «умными» препаратами. Многие из них способны улучшить умственную работоспособность отдельных областей в краткосрочной перспективе. Но уместно ли говорить о росте интеллекта? В краткосрочной перспективе производительность может быть улучшена двойным эспрессо или полуденным сном. Однако в качестве средства для увеличения интеллекта все это бесполезно. Хотя было бы возможно найти другие положительные эффекты уже широко распространенных ноотропов, стоит также помнить и о побочных эффектах.

В настоящее время существует слишком мало исследований, чтобы уверенно оценить, оказывают ли «умные» препараты существенное влияние на результаты тестирований интеллекта здоровых людей.

Другими словами, хотя ноотропы могут ненадолго повысить умственную продуктивность, в настоящее время нет доказательств существования IQ-таблетки, к которой обоснованно подходила бы характеристика «повышающая интеллект».

 

Стимуляция мозга магнитным стержнем

Возможно, химия – неправильный путь, и для роста интеллекта нужны более футуристические методы, чем консервативное глотание таблеток. В этих целях полезным может оказаться прибор, который выглядит, как гибрид волшебной палочки и волшебной лозы. Только речь идет не об эзотерической чепухе, а о нейробиологическом инструменте, который осуществляет «транскраниальную магнитную стимуляцию» (ТМС). Внутри устройства находится металлическая катушка, которая производит сильные электромагнитные импульсы, когда проносятся короткие импульсы тока. Помещенный непосредственно над головой, прибор влияет на активность отдельных областей коры головного мозга. В зависимости от частоты магнитных импульсов, эти области мозга могут быть стимулированы или подавлены. Каким-то образом магнитным полям удается запустить потенциал действия в нейронах. Это означает, что клетки мозга стимулируются для передачи нервных импульсов в другие клетки. Несмотря на интенсивные исследования, все еще неясно до конца, почему это работает. Но это не важно, ведь уже есть и другие отличные варинты применения.

При исследованиях в области нейронауки ТМС в основном используется для выяснения того, за какие задачи ответственны те или иные области мозга. В последние годы, тем не менее, публикуется все больше и больше исследований, в которых рассматривается потенциал ТМС для повышения умственных способностей. Результаты более 60 из этих исследований были собраны в обзорной работе 2014-го года. Хотя тема интеллекта в значении IQ или g-фактора в ней не затрагивается, в исследованиях выясняется, можно ли оптимизировать работу мозга для решения конкретных задач. И о чудо, это работает! И даже двумя разными способами. Либо путем прямой стимуляции нейронов, необходимых для решения задачи, либо путем подавления мешающей мозговой активности, которая не требуется для выполнения этой задачи. Таким способом во время исследования были улучшены многие умственные показатели, включающие внимание, хорошую память и понимание речи. Скорость движений глаз, а также поиск и распознавание объектов также могут быть улучшены. Если вы ищете допинговое средство для состязания в игре «Где Уолли?», то выбирайте ТМС вместо таблеток.

Причиной того, что эти эффекты носят временный характер, является чрезвычайно затрудненное ежедневное повышение продуктивности при помощи ТМС. Как на вас смотрели бы в лекционном зале, если во время экзамена вы водили бы по голове палкой, которая выглядит как увеличенных размеров вибратор фетишиста, свисающий с автомобильного аккумулятора?

Есть признаки того, что эффективность нейронных связей может быть увеличена с помощью ТМС в долгосрочной перспективе.

Чем чаще нейрон A комуницирует со вторым нейроном B, тем сильнее становится связь между этими двумя клетками и тем эффективнее они могут взаимодействовать друг с другом в будущем.

«What wires together, fires together», – как выразился твердо знающий свое дело нейробиолог-англичанин, «то, что связывается вместе, загорается вместе». Это называется правилом обучения Хебба, которое описывает реализацию процесса обучения в нейронных сетях. Вполне возможно, что необходимые нейронные сети во время изучения какой-либо деятельности можно сделать более эффективными на длительное время путем дополнительного повышения мозговой активности с помощью ТМС. Таким образом, ТМС мог бы ускорить процесс обучения навыкам, если ему удастся стимулировать те части коры головного мозга, которые для этого необходимы. Этот эффект уже может быть продемонстрирован, хотя и в небольших масштабах. Если вы несколько раз простимулируете моторную кору объектов исследования, пока те будут изучать сложный механизм движения большого пальца, они смогут выполнять движение еще лучше даже тогда, когда устройство уже выключено.

Эффект возрастания обучаемости от ТМС хотя и очевиден и измерим, все же не настолько велик, чтобы сделать из Пинки Брейна. Между тем исследования ТМС на предмет улучшения умственных способностей здоровых людей – область очень молодая. Авторы обзорной работы исходят из того, что достигнутые эффекты будут значительно улучшены благодаря нашему растущему пониманию ТМС. К тому же появляются полезные разработки, такие как полностью автоматизированные системы выравнивания магнитной катушки, которые обеспечивают точное до миллиметра расположение прибора с помощью способов визуализации. Вы можете себе представить, что все это не совсем дешево, и если почасовая оплата репетитора для вас – ночной кошмар, то устройство ТМС для личных нужд, скорее всего, будет за границами вашего семейного бюджета. Однако есть и другие, более приемлимые методы, которые можно использовать для воздействия на деятельность мозга извне.

 

Энергозатратная вспышка озарения

Транскраниальная стимуляция постоянным током (tDCS, на английском – transcranial direct current stimulation) настолько малозатратна, что фанатики нейрооптимизации начали собирать устройства в собственных гаражах. Подобно ТМС, транскраниальная стимуляция постоянным током способна влиять на нейронную активность коры головного мозга. Однако не при помощи магнитных полей, а едва ощутимыми импульсами тока, которые исходят из 9-вольтовой батарейки и через приклеенные электроды прогоняются сквозь мозг. Все большее число исследований обнаруживает положительное влияние tDCS на здоровых людей, в том числе улучшение рабочей памяти, повышение внимания, прогресс в процессе обучения в целом и даже повышение творческого потенциала.

В соревновательных видах спорта tDCS частично используется в тренировочных целях, так как увеличенная скорость нервной проводимости может положительно влиять на взрывную силу мышц и тем самым может, например, улучшить показатели в прыжках. В 2012 году расследование Министерства обороны США даже обнаружило, что tDCS повысила бдительность испытуемых: они в два раза быстрее распознавали бомбы, снайперов и другие опасности на фотографиях.

Эти сведения в сочетании с простой конструкцией устройства привели к тому, что несколько компаний теперь предлагают устройства tDCS для личного использования. Диапазон цен варьируется от 40 долларов за набор «Собери сам» до высококлассного прибора, рассчитанного на профессиональных спортсменов. Что касается фанатов нейрооптимизации, для которых это только хобби, едва ли возможно оценить, какие из этих устройств годятся, а какие прогоняют электрический ток через мозг просто для удовольствия или даже делают кое-что похуже. Исследование, проведенное в Нидерландах в 2016 году, продемонстрировало, что имеющееся в продаже устройство tDCS ухудшило рабочую память испытуемых. И всего лишь за несколько сотен евро!

Чтобы достичь желаемых результатов, многое должно быть сделано правильно. Если положение электродов изменить всего на несколько сантиметров, это уже может повлечь за собой сильный отрицательный эффект. Чтобы внести немного порядка в хаос, в 2017 году состоялась первая конференция, на которой исследователи tDCS и разработчики коммерческих устройств собрались вместе, чтобы обменяться идеями и разработать рекомендации, помогающие потребителям принимать правильные решения. В настоящее время, однако, частным пионерам tDCS приходится экспериментировать на самих себе и утешаться тем фактом, что, по крайней мере, не было обнаружено никаких значительных побочных эффектов.

 

Красный свет для всезнаек

В дополнение к магнитным полям и электрическим импульсам существует еще один экзотический метод воздействия на умственную работоспособность. Вы, наверное, знаете это из комиксов: как только у кого-то возникает хорошая идея, над его головой появляется лампочка. Но на самом деле причинная обусловленность работает в другом направлении: сначала – свет, затем – идея. Свет может проникать под нашу черепную крышку и запускать процессы метаболизма в мозге. Прежде чем бриться налысо и садиться под палящее солнце, учтите, что этот свет должен быть направлен на нужные области мозга и иметь определенную длину волны. Она должна быть в диапазоне от красной до инфракрасной, потому что более короткие длины волн рассеиваются в ткани, а более длинные – поглощаются водой. Как этот свет влияет на работу нашего мозга, стало понятно только недавно. Конечно, вы слышали о митохондриях, которые часто упоминались в школе как электростанции клетки. Их основная задача – обеспечение клетки энергией в виде АТФ (аденозинтрифосфата). Важную роль в производстве АТФ в митохондриях играет так называемая цитохром с-оксидаза. От нее поглощается световая энергия, что приводит к увеличению обмена веществ в митохондриях. Чем выше активность цитохром с-оксидазы, тем больше вырабатывается АТФ и тем больше энергии доступно клеткам мозга. В экспериментах на мышах было доказано, что освещение даже увеличивает кровоток в вовлеченных в работу областях мозга. Повышающие производительность эффекты освещения мозга были продемонстрированы в нескольких исследованиях, и, помимо прочего, они отражают повышение внимания и улучшение рабочей памяти. В небольшом исследовании даже были отмечены признаки поддержания положительного эмоционального состояния.

Не следует думать о том, как можно было бы тайно направить на кого-нибудь невидимый лазерный луч, чтобы повлиять на его умственные способности или эмоции. Но хватит спекуляций, нельзя забывать, что речь идет о молодой, экспериментальной области. Пока существует не слишком много исследований о влиянии световой терапии на здоровый мозг, а те, что мы имеем, проводились в основном в небольших масштабах. Таким образом, пройдет еще несколько лет, прежде чем будет достаточно серьезных исследований, чтобы надежно оценить потенциал светового излучения для повышения умственной работоспособности.

Но знаете ли вы, кого нельзя сдержать такими сомнениями? Представителей альтернативной медицины. Они годами использовали так называемую низкоуровневую лазерную терапию (англ. Low-Level-Lasertherapie, LLLT) для лечения болей и содействия заживлению ран. Даже в тех областях, где не было продемонстрировано никакого эффекта или доказана неэффективность.

Поэтому, пожалуйста, критически относитесь к медицинским заключениям, а в случае, если сомневаетесь, вспомните слова австралийско-британского комика Тима Минчина: «Знаете, как назвать альтернативную медицину, которая доказала свою эффективность? Медицина».

 

Биология человеческого поведения


 

Каждое утро одни и те же неприятности. Вы сидите за столом во время завтрака, открываете газету, в очередной раз читаете о политическом сдвиге вправо и думаете: «Эх, каким же прекрасным мог бы быть мир, если бы выборы избавили от участвующих в них паразитов». Знакомая ситуация? Нет? Тогда самое время изучить влияние биологии на вашу личность и политическое отношение!

Сразу после прочтения научно-популярной книги вы, вероятно, относитесь к людям, которые предпочитают думать о себе как о разумных существах. Вы думаете, что принимаете решения, основываясь на сознательных соображениях, и после долгих размышлений решили вложить средства в покупку этой книги, а не в «Поиски своего “я” через чакры единорога» с полки справочников по эзотерике. Но действительно ли вы приняли это решение настолько же осознанно, насколько это ощущается? Многое в нейронауке указывает на то, что наш мозг часто не принимает решения, основанные на осознанных рассуждениях. Кажется, что намного чаще он сначала неосознанно принимает решение, а наше сознание его впоследствии оправдывает.

К такому выводу пришли различные исследования, из которых наиболее известными стали работы испанского профессора неврологии Альваро Паскуаль-Леоне. Он смог показать, что на наши решения оказывается фундаментальное влияние, даже когда мы их уже приняли. И притом мы это даже не улавливаем. В одном эксперименте он дал испытуемым два коротких, следующих друг за другом звука. При звучании первого они должны были решить, каким из указательных пальцев им хочется двигать – левым или правым. При звучании второго они должны фактически выполнить движение. Но как только раздавался второй звук, Паскуаль-Леоне вмешивался в мыслительный процесс участников эксперимента. Вы помните о ТМС – транскраниальной магнитной стимуляции? Она позволяет стимулировать отдельные области мозга с помощью электромагнетизма. Но ее правильное приложение дает возможность повлиять на то, какой из указательных пальцев испытуемого будет двигаться при втором звучании – даже если он сам прежде решил выбрать другой. Поэтому участнику эксперимента ситуация видится, например, такой: услышав первый звук, он решит пошевелить указательным пальцем левой руки. Но как только он захочет сделать, услышав второй звук, шевелиться будет палец правой. Можно подумать, что испытуемый сочтет это крайне странным. Но нет. Если вы спросите участников исследования, почему они выбрали какую-то сторону, они в основном будут отвечать, что собирались ее выбрать или что поменяли решение. Чувство, что человек не контролировал собственное действие, отсутствует. Наш мозг рассказывает историю, будто он и так намеревался сделать это, что в результате и сделал, даже если организатору исследования о планах испытуемого было известно больше. Сначала приходит решение, а затем приходит сознание и рассказывается история, объясняющая почему. Таким образом, наше сознание не основоположник наших решений, а скорее что-то вроде пресс-секретаря мозга.

Наш мозг чаще логически оправдывает уже принятые решения, чем принимает их осознанно из конкретных посылок.

Эксперименты Паскуаль-Леоне не являются бесспорными, но многие исследования, проводящиеся другими методами, приходят к такому же выводу – и номером один среди них считаются методы американского физиолога Бенджамина Либета. Правда, эти результаты не накладываются без проблем на повседневные ситуации, в которых большее количество факторов играет роль в принятии решения. В повседневной жизни все-таки редко кто-то размахивает палочкой для ТМС вокруг головы. Тем не менее эти исследования показывают, что на наши решения оказывается влияние на фундаментальном уровне и без того, чтобы мы в этом непременно участвовали. И в биологии есть много примеров того, как наше мышление и поведение формируются под воздействием вещей, о которых вряд ли кто-то мог подумать.

 

Чумовой пир на весь мир

Неонацисты любят называть левых клещами. Фидель Кастро называл своих соотечественников, которые хотели уехать в США, червями. Тараканы, комары и черви были типичными обозначениями для тутси до того, как хуту устроил их народу геноцид.

Заметили кое-что? Все эти названия обозначают либо паразитов, либо переносчиков заболеваний. Тоталитарные режимы любят равнять своих врагов и будущих жертв. Это предваряло не только систематическое истребление евреев, но и «чистки» при Сталине. Совпадение? Враждебно настроенные идеологи поняли, как они могут использовать наш эволюционно закрепленный страх, что «чужак» может принести эпидемию. Это попытка изобразить свой народ как чистое тело, которое должно быть защищено от посторонних, приравниваемых к паразитам и возбудителям заболеваний. Превосходный способ лишения других человеческого облика. Те, кто испытывает страх перед чумой, будут безжалостны, убивая крысу. С эволюционной точки зрения, этот страх небезоснователен.

После прибытия европейцев в Америку от принесенных ими болезней погибло больше коренных жителей, чем от пуль испанцев.

В некоторых местах до 95% населения умирало от новых эпидемий, ранее не известных на континенте. В качестве компенсации аборигены подарили Европе сифилис.

На самом деле эволюция достаточно хорошо подготовила нас к таким встречам. Большинству возбудителей заболеваний не удается проникнуть в организм через нашу многослойную кожу, до отказа заполненную иммунными клетками, которые так и ждут, когда неосторожные захватчики решат попытать счастье. Привлекательные для патогенов входные ворота, такие как глаза и нос, выделяют жидкости, чтобы разоружить нежелательных гостей и безжалостно выставить их за дверь. Внутренняя поверхность легких производит вещество, убивающее бактерии. Вирусы, у которых получается заразить клетки, разлагаются на белки до генетического конфетти. Возбудителей заболеваний, которые преодолевают все эти препятствия, встречает армия иммунных клеток и белков, которые их съедят, растопчут, изрешетят и покромсают. Если бы наше тело было фильмом – Квентин Тарантино был бы режиссером. Но зачастую всех жестких мер тела оказывается недостаточно. Между людьми и их заразой существует постоянная, длящаяся тысячелетиями гонка вооружений. Иммунной системе европейцев пришлось очень долго вооружаться против гриппа, кори и других заболеваний. А вот защитные силы аборигенов Америки, например, были совершенно не готовы к этим завезенным инфекциям. В результате контакта с незнакомцами погибло несколько миллионов человек.

Внутренняя поверхность легких производит вещество, убивающее бактерии.

 

Бессознательный страх перед инфекциями

Длиннейший период времени в истории человечества инфекционные заболевания были причиной смерти номер один. Поэтому эволюция старалась всеми правдами и неправдами защитить нас от этого. При этом успех одной только иммунной системы явно ограничен. Все больше ученых высказывают предположение, что миллионы лет битвы с микробами не только изменили защитные силы нашего тела, но и оставили неизгладимый отпечаток на нашей психике. Они называют это «Behavioral Immune System» – поведенческой иммунной системой. В ней описан ряд психологических механизмов, которые часто незаметно влияют на наше поведение – из-за постоянной скрытой опасности заражения инфекцией. Термин был введен Марком Шаллером, профессором психологии из Университета Британской Колумбии. Он и его коллеги провели многочисленные эксперименты, чтобы изучить работу поведенческой иммунной системы. При этом они обнаружили эффекты, которые влияют не только на сосуществование отдельных людей, но и на все культурное пространство мира.

В некоторых областях существование поведенческой иммунной системы очевидно. Когда вы в последний раз ели экскременты животных? Или, по крайней мере, тыкали в них пальцем, а потом ковырялись им в носу? Как вы реагируете на рвоту? С интригующей заинтересованностью или все-таки стараетесь держаться от нее подальше?

Рвота, экскременты, гной и другие вещи, которые мы считаем отвратительными, как правило, нашпигованы всевозможными возбудителями заболеваний. Наше интуитивно возникающее отвращение, с другой стороны, свидетельствует о прагматическом понимании микробиологии, без необходимости вообще знать, что такое микробы.

Предположительно еще до развития микробной теории дети предпочитали плескаться в чистой воде, а не в яме с навозной жижей. Даже коровы и овцы неохотно пасутся возле своих фекалий, что помогает им избежать заражения червями.

Поскольку непосредственно возбудителя заболевания мы увидеть не можем, эволюция не может снабдить нас прямой неприязнью к микроорганизмам. Вместо этого она сделала все возможное и одарила нас отвращением к вещам и поведению, от которых зачастую исходит риск заражения. И эта ситуация не сильно поменяется, даже если опасности не существует с точки зрения современного молекулярного биолога. Предположу, что вы не захотите намазать сгусток гноя на свой хлеб, даже если его как следует прокипятили и там однозначно не осталось живых микробов. Если участникам исследования предложить кусочек шоколадного кремового торта, который был испечен в форме собачьей какашки, вероятнее всего, они от него откажутся, даже если будут знать, что это вкусное лакомство.

Задача поведенческой иммунной системы заключается, прежде всего, в том, чтобы держать нас подальше от вещей, которые могут представлять повышенный риск заражения. Пока речь идет об экскрементах и рвоте, никаких спорных моментов не возникает. Сложнее становится, когда те же соображения переносятся на другой крупный источник инфекций – на нас самих. Большую часть всех инфекций мы встречаем при прямом контакте с другими людьми. Поэтому было бы удивительно, если бы поведенческая иммунная система не влияла на наши межличностные отношения.

Большую часть всех инфекций мы встречаем при прямом контакте с другими людьми.

Мы предпочитаем людей, по внешним признакам вызывающих доверие, людям, которые кажутся нам чужими. Вы – нет? Отлично, вы – святой, живущий без греха. В общем, это так. Нравится кому-то или нет, но это выясняется в ходе исследований. Если вы хотите изменить это, потому что находите неприязнь к иностранцам, иррациональную стигматизацию и тому подобное глупым, вы должны попытаться понять как можно больше вовлеченных факторов, в том числе биологических. Но даже если вы принадлежите к фракции «Да, круто, расизм», потому что на уроке истории предпочитали смотреть в телефон, а не на доску, вам следует внимательно читать дальше. Когда кто-то спрашивает о причинах авторитарного мышления и неприятия людей, находящихся за пределами своей группы, он обычно слышит причины, отсылающие к воспитанию, средствам массовой информации и т. д. Это, несомненно, правильно, но ответ может быть неполным. В то же время бессознательный страх перед инфекцией редко упоминается, хотя все большее число исследований указывают на его наличие.

 

Ненависть к чужакам и паразиты

Один только вид больного человека или даже общее чувство отвращения могут подготовить нашу иммунную систему реагировать особенно агрессивно. По крайней мере, к такому выводу привели несколько небольших исследований последних лет. Правда, нужно все же убедиться в том, могут ли результаты быть воспроизведены. Неудивительно, что мы избегаем контакта с людьми, которые выглядят так, как будто в любой момент могут закашлять нам в лицо, в том числе мокротой. Джейн Гудолл смогла показать, что даже ее любимые шимпанзе стараются не иметь дел с больными сородичами и изолируют их от группы. Однако мы, люди, пошли еще дальше и применяем эту меру предосторожности в отношении целых групп населения, на которых лежит клеймо повышенного риска заражения: чужаки. Говорят, что они не только способны передавать экзотические заболевания и паразитов, но также и то, что они менее строго придерживаются социальных стандартов, которые, помимо прочего, служат для соблюдения стандартов гигиены, позволяющих избежать инфекций.

Вообще, отстранение от чужаков кажется свойственным большинству людей. По крайней мере, все программы партий основаны на этом. Но это отстранение, видимо, усиливается, когда общая опасность инфекции доходит до сознания. Канадским участникам исследования была показана одна из двух серий изображений. Первая показывала риски заражения, вторая – изображение других угрожающих жизни опасностей. После этого было измерено, насколько ксенофобским было настроение испытуемых. Те, которые ранее сталкивались с темой инфекции, занимали более враждебно настроенную позицию по сравнению с теми, чье внимание было обращено на другие опасности. Объясняет ли это ранее упомянутую страсть к инфекционному вокабуляру идеологий, которые выражают презрение к человеку?

В исследовании также рассматривалось, влияет ли ощущение уязвимости здоровья на ксенофобские настроения людей. Для этого испытуемым нужно было указать, насколько они согласны с различными утверждениями, – например, «Моя иммунная система защищает меня от большинства болезней, которыми страдают другие люди» или «В прошлом я был крайне склонен к заражению инфекционными заболеваниями». В итоге пришли к выводу, что люди, которые считают себя особенно склонными к заражению, имеют и предрасположенность к ксенофобии.

Однако в этом эксперименте речь идет о чисто субъективном ощущении уязвимости. Но как же быть с людьми, которые на самом деле особенно подвержены риску заражения? Этот вопрос стал главной темой американского исследования 2007 года при участии более 200 беременных женщин. Настоящее чудо рождения заключается в том, что женская иммунная система не начала избавляться от маленького полупаразита.

С точки зрения организма матери, малыш наполовину состоит из чуждой организму генетической информации, с которой иммунные клетки матери обычно быстро расправляются. Чтобы этого не произошло, иммунная система женщины подавляется в течение первых четырех месяцев беременности.

Только после этого она медленно перезапускается, и у плода развивается собственная иммунная система. В первые месяцы беременности, когда ослабляется иммунитет, у женщин развивается особая чувствительность к запахам, вкусам и внимательность к вещам, вызывающим отвращение. Такое, конечно, не делает жизнь приятнее, но есть веская причина, почему это необходимо. Считается, что дело касается стратегии поведенческой иммунной системы, которая побуждает женщин особенно надежно отгородиться от потенциальных источников инфекции в их ослабленном состоянии. Вместе с тем исследование обнаружило еще один эффект беременности, который может преследовать ту же цель. Тогда как в течение первых нескольких месяцев беременности женщины, похоже, позитивно настроены по отношению к членам своего общества, с «чужаками» они все же держат дистанцию. В более поздние месяцы беременности, когда иммунная система возвращается в нормальное состояние, отношение беременной женщины к чужакам возвращается в исходное состояние.

Данные, полученные Марком Шаллером и другими учеными, указывают на то, что, ощущая себя в условиях повышенного риска заражения инфекционными заболеваниями, люди менее открыты для новых идей и опыта и, следовательно, менее экстравертированы и большее значение придают социальной адаптированности.

Иногда это приводит к тому, что они строят более строгие моральные суждения о людях, нарушающих социальные нормы. То, что наше понимание морали может попасть под влияние простых биологических обстоятельств, идея не новая.

Еще в 2011 году одно исследование показало, что чувство отвращения, вызванное употреблением горького напитка, заставляет нас более резко осуждать моральные ошибки.

Если вы когда-нибудь предстанете перед судом и судья потянется за грейпфрутовым соком, – всеми силами постарайтесь выбить стакан из его рук.

Другие научные наблюдения предполагают, что мы могли бы использовать эффекты поведенческой иммунной системы в своих интересах. Например, готовность использовать презерватив может быть увеличена за счет неприятных запахов. При изучении этого вопроса исследователи использовали запах, который обычно сопряжен с источником инфекции: спрей с запахом пердежа «Текущий зад». Желание использовать презерватив после такого благодеяния для обонятельной системы должно являться бессознательным механизмом, позволяющим убрать со своего пути возбудителей заболеваний. Поэтому, если нужно предотвратить нежелательную беременность после попойки, стоит в следующий раз не тратить время на очищение унитаза в ночном клубе и умышленно покакать в углу.

Люди с ярко выраженными проявлениями поведенческой иммунной системы особенно консервативны во многих областях. Такой вывод был сделан в обзорной работе 2013 года, в которой обобщены данные 24 исследований. Люди с сильным чувством отвращения и страхом заражения более склонны к авторитарному мышлению, религиозному фундаментализму и более предвзяты по отношению к другим группам. При этом речь идет не только о временных эффектах, влияющих на отдельных людей в лабораторных условиях. На уровне целых наций также существуют различия в консервативных представлениях о ценностях. В странах, которые в историческом прошлом особенно страдали от заражения паразитами, в среднем преобладают более консервативные представление о сексе. Кроме того, люди в таких обществах менее экстравертированы, более негативно настроены по отношению к другим этническим группам и предрасположены к авторитарному мышлению не только на индивидуальном уровне, но и на национальном.

 

Перехитрить поведенческую иммунную систему

Поведенческая иммунная система так сильно развита, потому что она защищала наших предков от инфекций. Неспособность распознать, что кто-то представляет собой угрозу заражения, часто оказывалась смертным приговором. К тому же серьезных последствий не будет, если на всякий случай держаться подальше и от здорового человека. Поэтому стратегии уклонения поведенческой иммунной системы склонны к чрезмерной реакции. Они заставляют нас сторониться людей, даже когда мы четко осознаем, что опасности для нас нет. К таким случаям относятся контакты с людьми с ограниченными возможностями или изувеченными лицами. Однако стратегии уклонения поведенческой иммунной системы затрагивают также и целые группы населений, например, когда они ассоциируются с экзотической пищей, другими стандартами гигиены и непривычными сексуальными практиками. Но есть ли в этом смысл сегодня? В конце концов, инфекционные заболевания уже давно вытеснены из ряда основных причин смерти благодаря методам гигиены и современной медицине.

Вопрос о том, имеет ли поведенческая иммунная система какой-то смысл в современном мире, до сих пор не изучен. Немногочисленные существующие исследования указывают на то, что ответ скорее «нет». Исследованию, целью которого было установление связи между выраженным чувством брезгливости и лучшим здоровьем, это обнаружить не удалось. Не существует данных, подтверждающих, что консервативная точка зрения или ксенофобия связаны со сравнительно более крепким здоровьем. Можно было бы почти предположить, что ксенофобия уже неуместна в то время, когда день начинается с венского завтрака, продолжается китайским обедом, перекусом шаурмой и завершается уплетанием итальянской кухни в Frutti di Mare. Все указанные наработки предполагают, что поведенческая иммунная система особенно усиливает консервативные ценности, авторитарное мышление и отстранение от «чужаков» в том случае, когда люди подвергаются острому риску заражения или, по крайней мере, полагают, что он есть. Причина, по которой эти меры предосторожности не сохраняются в остальных случаях, заключается в том, что в экстравертированности и открытости может быть смысл. Поэтому в плане отношений мы остаемся гибкими, чтобы принимать лучшие решения в зависимости от наличия или отсутствия угрозы заражения. Однако в то время, когда инфекционные заболевания становятся все менее опасными, а смешивание наций неумолимо усиливается, анализ затрат/эффективности поведенческой иммунной системы может совсем не порадовать. Можно даже высказать спекулятивное предположение, что поведенческая иммунная система с сегодняшней точки зрения вызывает больше проблем, чем решает.

Так что же можно с этим поделать? Несколько исследований определили, что меры для поддержания общественного здравоохранения могут сдержать не только распространение болезней, но и предрассудки по отношению к чужакам. Эксперимент, проведенный в 2009 году в разгар эпидемии свиного гриппа, выявил связь между отсутствием вакцинации и ксенофобией. Для этого участникам исследования дали для прочтения газетные статьи, напоминающие об опасности свиного гриппа. Затем им было предложено пройти тесты на расизм. Невакцинированные испытуемые были настроены более враждебно по отношению к мигрантам, чем вакцинированные. Кажется, будто осознание защиты вакцины от свиного гриппа увеличило их открытость по отношению к иностранцам. Но даже простейшие методы гигиены могут повлиять на наше отношение к представителям других национальностей. В том же исследовании была выявлена связь между очищением рук и отношением к людям, не принадлежащим к группе испытуемых. Участники проявили более позитивное отношение к незнакомым людям, если они перед заполнением цифровой анкеты протирали руки и клавиатуру антибактериальной салфеткой. Организаторы эксперимента заключили, что меры, принятые для улучшения здоровья населения, служат не только для предотвращения болезней, но и для устранения предрассудков. Связь между физическим очищением и психическим ощущением давно используется и вне подобных исследований. Многие тысячелетия на религиозных встречах обязательно должны были присутствовать мужчины в белых одеждах и ритуалы очищения тела. У христиан, мандейцев и почитателей сикхизма принято считать, что грехи смываются водой при крещении. Без вуду, ритуального омовения в исламе, мусульмане наслаждаются проповедями и службами лишь вполовину. То, что лежит в основе этих ритуалов, называется «эффектом леди Макбет», названным в честь Леди Макбет, героини Шекспира, которая, преисполнившись чувством стыда, моет руки после каждого убийства. Писатель описывает феномен того, что физическое очищение также влияет на наше умственное самовосприятие – в особенности на чувство моральной чистоты. И если все делать правильно, использовать мыло вместо магических формул, эти очищающие ритуалы действительно могут помочь в борьбе с инфекциями.

Раньше брезгливость спасала от потенциального заражения. В современном мире это уже не работает.

А теперь – к обязательным словам предупреждения. Плодами всех упомянутых исследований следует наслаждаться с осторожностью. Для того чтобы делать крепкие с научной точки зрения заявления, необходимо провести множество наблюдений и экспериментов в разными исследовательскими группами, и все они должны прийти к схожим результатам. Изучение поведенческой иммунной системы – область очень молодая. Во многих из описанных здесь исследований не было большого количества испытуемых. Благоразумнее все же было бы подождать десять лет, чтобы увидеть, какое из них можно будет повторить более широкомасштабно. Вот причина, по которой я не настолько благоразумен: если серьезно относиться к результатам этих исследований, последствия поведенческой иммунной системы могут быть настолько значительными, что их ни в коем случае нельзя игнорировать. Если многие небольшие исследования сходятся во мнении, что на неприязнь к чужакам влияет бессознательный страх перед инфекцией, велика вероятность, что в этом действительно что-то есть. Тем не менее биологические факторы влияния практически никогда не упоминаются, когда речь заходит о такого рода враждебных настроениях.

Если исследователи правы и ощущение уязвимости к инфекции идет рука об руку с ксенофобией, любая победа над заразной болезнью помогает увеличить наши шансы на развитие более открытого общества.

 

Измерение личности

Если считать открытость хорошим качеством, можно рассматривать ее в качестве элемента для оптимизации всего общества. Но если вы заглянете глубоко в себя, вероятно, обнаружите, что на самом деле вам в общем-то безразлично общество и вы заинтересованы только в себе самом. К вашему счастью, открытость растет и на индивидуальном уровне. И даже без мытья рук. Это удастся сделать даже в пределах кратчайшего периода времени, если вы готовы нарушить закон. Но прежде чем вы получите свою заслуженную запись в реестре осужденных, вам следует хотя бы узнать, что вообще означает открытость. И как личность может быть измерена в принципе.

Как бы вы описали себя в профиле Тиндера? «Кевин, 29 лет, темперамент огненный, как перец чили, характер, как у Иисуса»? Такие термины, как темперамент и характер, уже давно используются в психологии для описания личности человека. Между тем, они оказались не слишком полезными и больше не используются в исследованиях. Сегодня очень популярный личностный тест приписывает людям один из четырех цветов: красный, синий, зеленый или желтый. Все они представляют определенные типы личности. Особенно любят использовать эту четырехцветную модель различные компании в целях более удобной классификации сотрудников и руководителей. К преимуществам этого теста относятся интуитивная передача смысла и легкость для понимания, правда, есть и недостаток, он состоит в том, что уровень информативности теста не намного выше, чем у гороскопов.

В современных психологических исследованиях осуществляется другой метод тестирования, потому что он, бесспорно, наиболее убедителен: тестирование личности «Большая пятерка». Характер человека делится на пять областей: экстраверсия, невротизм, открытость, уживчивость и добросовестность. В отличие от четырех цветов, это деление не было выбрано произвольно. Оно восходит к систематическому анализу тысяч определений из словарей. Основополагающим принципом является то, что важные различия, которые могут существовать между людьми, уже должны быть представлены соответствующими терминами в словарях. Оказалось, что все термины, описывающие личность человека, можно классифицировать по этим пяти категориям.

При помощи так называемого факторного анализа были описаны эти совершенно устойчивые, в значительной степени независимые друг от друга категории личности, которые сегодня образуют стандартную модель в исследовании личности на международном уровне.

Чтобы иметь возможность классифицировать личность человека, ему предлагают заполнить длинный опросник с большим количеством вариантов ответов, которые могут быть отнесены к пяти категориям. Вот несколько примеров, чтобы вы имели об этом некоторое представление:

Экстраверсия (Общительность): «Я охотно окружаю себя большим количеством людей».

Невротизм (Эмоциональная неустойчивость): «Я легко прихожу в состояние волнения».

Открытость (Для опыта): «Меня очень интересуют философские дискуссии».

Уживчивость (Внимательность, сочувствие, вежливость): «Я постараюсь со всеми быть дружелюбным».

Добросовестность (Перфекционизм, прилежность): «Я всегда держу свои вещи в чистоте и порядке».

В отличие от теста «4 цвета», упомянутого выше, результаты не будут отнесены к каким-нибудь произвольным типам характеров. Вместо этого результаты сравниваются с результатами остальной части населения – аналогично тесту IQ. Результат теста может выглядеть следующим образом. Перцентиль экстраверсии 95 – если бы вы были одним из 100 человек в комнате, вы были бы более экстравертированными, чем 95 из них, и менее экстравертированными, чем четыре. Перцентиль добросовестности 5 – если бы вы были одним из 100 человек в комнате, вы были бы менее добросовестны, чем 94 из них, и более добросовестными, чем пять. В данном случае результаты говорят о том, что вам нравится устраивать вечеринки, но, как только дело доходит до уборки, вы предпочитаете смотаться.

Если вы оставите людям свободу выбора, они часто интуитивно принимают решения, которые, согласно «Большой пятерке», гармонируют с их личностью. Например, мужчины с низким уровнем уживчивости чаще выбирают военную службу, в то время как показатели уживчивости среди выбравших альтернативную гражданскую службу выше. В отличие от таких терминов, как «характер» и «темперамент», тест «Большая пятерка» имеет решающее преимущество: он не дает оценки. Нет никаких суждений относительно того, является ли конкретный показатель хорошим или плохим. Это не будет работать вообще, потому что степень полезности отдельных индивидуальных качеств личности зависит от ситуации. Например, высокий показатель уживчивости сделал бы вас отличным собеседником, но, будучи полицейским, вам бы это скорее мешало, потому что данное свойство в некоторых случаях, очевидно, сопровождается огромным страхом перед конфликтами. Невротизм, может, и делает вас нелегким спутником жизни, но зато вы определенно не допустите вашего ребенка с вилкой к розетке. «Большая пятерка» нейтральна в своих оценках.

Возможно, однажды вы уже опрометчиво выразили предположение, что черты личности мужчины и женщины, в среднем, имеют отличия. Даже учеными иногда овладевают такие мысли. Но они не позволяют пленить себя какому-нибудь «Мужчины с Марса, женщины с Венеры», а запираются в офисе, чтобы составить смету расходов на финансирование грядущих исследований. Одно из самых масштабных к настоящему времени появилось в середине 2018 года: в нем были проанализированы данные о личностях более 320 000 человек и исследованы на предмет гендерных различий. Мужчины и женщины достигают примерно одинаковых показателей при оценке уровней добросовестности и экстраверсии. В сравнении с джентльменами у дам открытость выражена немного более ярко. Однако большие различия все же обнаруживаются в уживчивости и невротизме. Тут женщины явно опережают мужчин. В среднем эти характеристики были настолько более выраженными у женщин, что, если бы кто-то сравнил случайного мужчину и случайную женщину из населения, женщина имела бы более высокие значения невротизма в двух третях всех случаев, была бы более сострадательной и более альтруистичной.

В 2/3 случаев женщины более сострадательны и альтруистичны, чем мужчины.

К такому выводу пришли не только многочисленные исследования «Большой пятерки», но и практические поведенческие эксперименты. Долгое время основным предположением было то, что с прогрессированием социального равенства и переосмыслением классических гендерных ролей различия личностей мужчин и женщин постепенно исчезнут. Но это оказалось заблуждением. Исследования, сравнивающие многие страны, показывают, что, чем больше общество придает ценности индивидуальности и равным возможностям, тем больше измеренные различия личностей разных полов. Никто этого не ожидал.

В прогрессивных Нидерландах можно найти значительно более выраженные гендерные различия, чем, например, в Зимбабве.

Почему так, никто не знает. Но крупнейшие обзорные работы постоянно обнаруживают один и тот же эффект. Чем больше усилий общество прилагает для уравнивания отношения к обоим полам, тем более выраженными становятся межличностные различия.

Вне всяких сомнений, мужчины и женщины имеют больше общих черт, чем различий – с точки зрения генетической, физической и психологической. Говоря обо всех поддающихся измерению чертах, бóльшие различия встречаются среди представителей одного пола, а не разных. Тем не менее разговоры о личностных различиях между мужчинами и женщинами зачастую оставляют неприятный осадок. Отчасти потому, что отдельные черты личности часто рассматриваются или как хорошие, или как плохие. Особенно невротизм, показатели которого в среднем выше у женщин, имеет плохую репутацию. При этом на индивидуальные черты личности в основном нельзя навешивать ярлык «абсолютно хорошая» или «абсолютно плохая» – они существуют, потому что необходимы в определенных ситуациях.

Исследование 1,5 миллиона пациентов больниц показало, что под наблюдением женщин-врачей умирает чуть меньше пациентов, чем у их коллег мужского пола. Почему это так, никто не знает, однако все же есть некоторые предположения. Например, было доказано, что женщины-врачи принимают больше профилактических медицинских мер, чем их мужчины-коллеги. Откуда это берет начало? Может ли это быть связано с личностными различиями? Это не было исследовано напрямую, но было бы неудивительно. Последовательное соблюдение профилактических мер – это именно то, чего можно ожидать от людей с более высокими значениями невротизма.

 

Привлекающий и доминирующий

«Don’t know much about history. Don’t know much biology. Don’t know much about a science book. Don’t know much about the French I took. But I do know that I love you. And I know that if you love me, too – what a wonderful world this would be», – текст песни Сэма Кука Wonderful World.

В начале моего изучения биологии я часто садился с дружественными сокурсниками, чтобы вместе с ними готовиться к ужасающему решающему экзамену по химии. Мы были напряжены, потому что с порогом в 80 % здесь была такая же частота отсева учащихся, как при поступлении в Navy Seals. Периодически это было довольно демотивирующе. Но всякий раз, когда фрустрация достигала своего апогея, ТомТом (прозвище) пытался поднять боевой дух, напевая вступительные строки Wonderful World, особенно выделяя момент «Don’t know much biology». Ключевой посыл песни в том, что в жизни есть более важные вещи, чем объективные профессиональные знания, и вы можете быть уверены в этих вещах – например, в том, насколько сильно вы любите кого-то. Но так ли это? Или можно оказаться введенным в заблуждение собственными эмоциями?

Любовь и привлекательность часто не следуют какой-либо прозрачной логике. Поэтому в разговорной речи часто используется выражение «Любовь ослепляет». Это, конечно, бред, иначе сексуальное нижнее белье не было бы таким ходовым товаром.

С подобными противоречиями ученые не могут просто смириться – они рьяно исследуют скрытые факторы влияния, которые делают вопрос привлекательности таким непрозрачным.

В 1974 году два американских психолога опубликовали результаты своего ставшего впоследствии известным эксперимента, который они провели на двух пешеходных мостах через каньон Капилано в Канаде. Один из них был шатким, узким подвесным мостом, который во время шторма качался на высоте около 70 метров над валунами. Другой мост был широким, устойчивым и располагался ниже, над идиллической рекой. К мужчинам, которые пересекали эти мосты, обращалась привлекательная молодая женщина, которая была членом исследовательской группы. Симпатичная леди просила мужчин заполнить анкету и давала им свой номер телефона, если у них возникнут дополнительные вопросы. В последующие дни молодой женщине позвонили несколько участников исследования. При этом было выявлено, что мужчины, которых она встречала на опасном мосту, звонили гораздо чаще. Кроме того, при заполнении анкеты эти люди чаще писали на сексуальные темы, чем те, кто переходил более надежный мост. Почему так?

 

Ложное приписывание волнения

Объяснение этого кроется в феномене, обозначаемом как «ложное приписывание волнения». Большинство людей думают, что мы сначала испытываем эмоцию, а затем ощущаем сопутствующие физиологические явления. Например, то, что мы находим кого-то привлекательным, после чего наше сердцебиение учащается и наши руки начинают потеть. На самом деле все наоборот: сначала наступает физическая реакция, а затем мы ищем для нее объяснение.

Когда пишем контрольную, нам легко понять, что потоотделение, дрожь и учащение пульса связаны с тем, что мы слишком много времени проводим с Netflix и слишком мало – с учебой. Однако причиной потных ладошек и учащенного сердцебиения может быть не только страх перед экзаменом, но и ряд других причин: например, нахождение рядом с кем-то, кто кажется невероятно сексуальным. Находясь одновременно в нескольких ситуациях, каждая из которых вызывает одни и те же физические симптомы, нам трудно определить, что стало их причиной. В случае эксперимента с мостами это означало, что испытуемые не могли четко различить, были они так взволнованны, потому что стояли на шатком мостике или все дело в привлекательности симпатичной леди. В результате той женщине решили позвонить 50% мужчин с опасного моста и только 12,5 % мужчин, которые прогуливались по скучному мосту.

Волнующий контекст заставляет нас воспринимать потенциальных партнеров более сексуальными.

Недавние исследования обнаружили аналогичные эффекты. Люди оценивали фотографии представителей противоположного пола как более привлекательные, если они предварительно катались на захватывающих американских горках. Кроме того, после поездки они говорили, что хотели бы встретиться с человеком на фотографии. Ложное приписывание волнения может быть одной из причин, по которой влюбленные голубки любят ходить в кино на фильмы ужасов. Правда, это работает в обоих направлениях. Если кто-то находит своего визави абсолютно непривлекательным и отталкивающим, это восприятие также может быть усилено ложным приписыванием волнения. Так что лучше не смотрите со своей половинкой «Властелина колец», если вы сами выглядите, как орк.

Исследование, проведенное Венским университетом в 2017 году, показало, что музыка также влияет на наше восприятие привлекательности. Сначала музыкальные произведения оценивались по тому, насколько волнующими они были для слушателей. Потом для женщин проигрывались разные музыкальные произведения, после чего они должны были оценить привлекательность мужских лиц на экране. Чем более волнующей была музыка, тем более высокой была оценка уровня привлекательности и желание пойти на свидание с показанными мужчинами. Здесь опять же ощущение взволнованности, вызванное музыкой, неосознанно переносилось на рассмотрение потенциальных сексуальных партнеров. Это исследование показывает, насколько важна работа хороших диджеев в контексте содействия беспомощным клаберам в совершении первого шага к половой жизни. При этом музыкальные произведения не были классическими хитами вечеринок. Это была фортепианная музыка XIX века, которая, по сути, не славится тем, что заставляет женщин таять. Но, эй, не просто же так говорят, что Моцарт умер от сифилиса.

 

Тестостерон – недопонятый гормон

Генетики, конечно, не попадутся на такие дешевые трюки. Если не складывается с физической привлекательностью, они просто сделают несколько москитов, которые будут сосать не кровь, а жир. Кроме того, исследователи обладают таким высоким уровнем уважения в обществе, что им в любом случае никто не может противостоять. В дополнение к привлекательности статус является одним из факторов, который играет важную роль в выборе партнера. По крайней мере, так говорят. Но правда ли это? В 1986 году психологи попросили участников исследования оценить 76 характеристик человека в зависимости от того, насколько они важны при выборе партнера. В тройку лидеров вошли «доброта и понимание», за ними последовали «захватывающая личность» и «интеллект». Привлекательность и статус при этом не сыграли существенной роли. Вывод исследования таков: люди лгут так, будто завтра не наступит!

Эксперименты, которые измеряют не то, что люди говорят в анкетах, а то, как они на самом деле действуют, показывают, что физическая привлекательность имеет чрезвычайно большое значение, за ней сразу же следует статус – во всех его проявлениях: доход, образование и так далее.

Мужчины, в частности, выигрывают от высокого социального статуса при выборе партнера. Чтобы достичь этого, они получают поддержку от вещества, большие дозы которого плавают в их крови: тестостерона. Долгое время считалось, что этот половой гормон способствует агрессии. Нельзя сказать, что это утверждение в корне неверно, но оно применимо только к некоторым ситуациям. Ранние исследования тестостерона часто проводились при участии заключенных. При этом выяснилось, что высокие показатели уровня тестостерона связаны с агрессивным поведением. Сегодня же нам известно, что тестостерон работает гораздо более сложным образом. Как правило, он в целом повышает мотивацию к росту в социальных иерархиях. С другой стороны, в больших офисах довольно редко продвигают по службе только потому, что сотрудник прописал боковой удар в челюсть татуированному бугаю из другого филиала.

Ранние исследования тестостерона зачастую проводились на заключенных. Отсюда его ассоциация с агрессией.

Недавно проведенное исследование показало, что после введения тестостерона мужчин начинают больше привлекать потребительские товары, которые считаются символами статуса. Другие исследования выявили, что тестостерон также может способствовать социальной, неагрессивной манере поведения, если она помогает подниматься по иерархической лестнице. В некоторых исследованиях введение гормона усиливало у участников щедрость, честность и готовность к сотрудничеству. При правильных условиях не так страшен тестостерон, как его малюют.

Так что же можно сделать, если хочется получить больше?

И снова несколько практических советов.

1. Затейте драку: даже ожидание участия в борьбе повышает уровень тестостерона у мужчин. При этом речь не идет о простой потасовке на заднем дворе: даже легальные спортивные соревнования реализуют эту функцию. Уровень тестостерона увеличивается и в ходе турнира по фрисби. И чем больше задействовано людей противоположного пола, тем больше вырабатывается тестостерона, что сразу же подводит нас к следующему пункту.

2. Общайтесь с привлекательными женщинами: в ходе одного исследования студенты-мужчины должны были вести небольшую беседу – либо с женщинами, либо с другими мужчинами. Значения тестостерона увеличивались только тогда, когда мужчины разговаривали с женщинами. Кроме того, они были особенно высоки у тех участников эксперимента, которые приложили все усилия, чтобы произвести впечатление на собеседниц. Другое исследование показало, что разговоры с женщинами повышают уровень тестостерона, особенно когда последний раз мужчина занимался сексом больше месяца назад.

3. Купите себе Porsche: исследователями были измерены показатели тестостерона в то время, как мужчины мчали по району либо в новеньком Porsche Cabriolet, либо в 19-летнем семейном автомобиле Toyota Camry. Porsche заставил показатели тестостерона у мужчин расти, а семейный автомобиль – нет.

Если вы слишком стеснительны, чтобы разговаривать с женщинами, слишком неспортивны, чтобы участвовать в турнире по фрисби, и с большим трудом можете позволить себе велосипед, не то что Porsche, вы будете рады услышать, что есть и другие механизмы, которые могут влиять на доминирующее поведение и сигнализировать о статусе. У многих видов животных высокий уровень тестостерона и доминирование связаны с красным цветом, например, кожа приматов мандрилов приобретает более красный оттенок, когда они достигают ранга альфа-самца. Однако если они теряют это положение, цвет их кожи становится более ярко выраженным синим. Было даже выявлено, что макаки-резусы особенно старательно избегают ученых, когда последние одеты в красную одежду. Может быть, у вас больше общего с этими приматами, чем вы думаете.

Даже ожидание участия в борьбе повышает уровень тестостерона у мужчин.

Исследования показали, что красный цвет кожи человека коррелирует с уровнем тестостерона. Кроме того, оттенок меняется в зависимости от наших эмоциональных состояний, в результате чего покраснение увеличивается из-за гнева, а из-за страха уменьшается.

Если хотите стать более доминирующим, вы можете провести час под палящим солнцем и пребывать в состоянии тестостероновой бомбы до тех пор, пока ваша красная кожа не облезет.

В качестве альтернативы можете просто носить красную футболку. Согласно последним исследованиям мужчины в красных футболках производят впечатление более агрессивных и доминирующих над другими мужчинами, чем в синих или серых. И не без причины: в самом деле, мужчины с высоким уровнем тестостерона перед соревнованиями часто выбирают красную одежду, если им предоставляется выбор.

Однако красная майка может иметь эффект, даже если человек выбирает ее не сам. На Олимпийских играх 2004 года спортсмены, представляющие четыре вида боевых искусств, случайным образом оказались либо в красных, либо в синих костюмах. Во всех четырех дисциплинах и во всех весовых категориях спортсмены в красной одежде побеждали чаще, чем спортсмены в синей. В других агрессивных видах спорта, таких как футбол, вы также найдете доказательства того, что у вас больше шансов выиграть в красных трико. Возможным объяснением этого может быть то, что сигнальный цвет пугает конкурентов. Возможное запоздалое последствие нашего эволюционного прошлого. И все же в качестве ложки дегтя отмечу, что люди в красных майках в «Звездном пути» всегда умирают первыми.

 

Голубой свет на пути к боссу

Но даже без красочных цветов и гормональных терапий может быть способ поспособствовать стремлению к статусности. В 2017 году ученым удалось катапультировать покорных мышей на вершину иерархии грызунов путем прямого вмешательства в мозг. При этом исследователи смогли за доли секунды превратить животных низкого ранга в напористых мышей, которые выходили победителями практически из всех конфронтаций. То, какая мышь находится в высшем эшелоне, можно узнать по тому, что доминирующие мыши обеспечивают себе теплые углы в клетке, получают привилегированный доступ к еде и бессовестно писают по всей территории жилища. Однако лучший способ определить социальную структуру – это использование теста с трубками. С обеих сторон узкой трубки одновременно заставляют забраться в нее двух мышей, при этом мышь, находящаяся выше по иерархии, будет оттеснять «подданную» и выталкивать назад из трубки. Точно как те отвратительные люди, которые заходят в вагон метро, вместо того чтобы выпустить выходящих.

С некоторых пор ученые стали предполагать, что область мозга, называемая дорсомедиальной префронтальной корой (Dorsomedial Prefrontal Cortex, или dmPFC), расположенная на передней части головного мозга, отвечает за социальное поведение и доминирование. У животных, живущих согласно законам социальной иерархии, помимо прочего, эта область мозга ответственна за то, чтобы животные осознавали свое положение.

Мы тоже относимся к таким животным, за исключением того, что наша социальная структура состоит не из единственной иерархии, а из множества разных иерархий одновременно для каждого человека. Когда вступаем в ряды полицейских инспекторов, мы перемещаемся в другую иерархическую структуру, отличную от царящей, например, в университете или в кругу семьи.

Успех делает уверенным в себе, а уверенность в себе – успешным.

Обычно после установления такие иерархии остаются относительно стабильными во времени. Даже у мышей – если только вы не экспериментируете с их dmPFC. Исследователи использовали метод, который называется оптогенетика. При помощи вирусов в клетки мозга вводится ген, делающий их светочувствительными и заставляющий активизироваться, как только они облучаются синим светом. Таким образом, инфицированные области мозга как бы активируются скоростью света. Для этого в голову мыши помещается светопроводящий оптоволоконный кабель, и устройство приводится в действие путем переключения тумблера. Таким образом, исследователи сделали dmPFC мышей светочувствительными, а затем провели с ними тест с трубками. Как правило, самцы более высокого ранга показывают превосходство. Но когда исследователи включали синий свет, активируя тем самым область мозга, отвечающую за доминирование, нижестоящие в иерархии мыши обретали натуру бойцов в считаные секунды и выходили победителями почти из всех противостояний – даже с сородичами, против которых у них не было бы шансов выиграть, при обычных обстоятельствах. При этом показатели уровня тестостерона животных оставались неизменными и их общая агрессивность не возросла. Активация увеличивала только упорство мышей, их смелость и их мотивацию пробиваться вверх по иерархии.

Но самое интересное произошло тогда, когда исследователи снова выключили свет. Большинство мышей вернулись к своим прежним ролям, заняв место внизу иерархической лестницы. Но не все. Те, кто благодаря голубому свету выиграл в испытании в трубках по крайней мере шесть раз, сохранили свою доминантность, даже когда их мозг больше не стимулировал оптогенетический допинг. В области мозга этих мышей развивалась более эффективная нервная проводимость, поэтому они на долгое время сохранили свою позицию на вершине иерархии. Людям также известен этот феномен – его называют эффектом победителя: успех делает уверенным в себе, а уверенность в себе, в свою очередь, делает успешным.

Таким образом, каждый успех увеличивает шансы на дальнейший успех. Самоусиливающийся цикл, который, очевидно, действует, даже если первоначальные успехи являются результатом доминирующего поведения, подаренного нейронаукой.

Предположу, что вам интересно, может ли это сработать на вас. Но действительно ли вы готовы к тому, чтобы в ваш мозг вкололи вирусы и вставили в голову оптоволоконный кабель только лишь для того, чтобы вытолкнуть из трубки типа, который всегда дразнил вас в школе? Если нет, то можно ли достичь подобных результатов, используя транскраниальную магнитную стимуляцию? Знания, полученные в экспериментах с иерархией мышей, довольно новые, и может ли человек начать доминировать под влиянием стимуляции dmPFC, следует сначала проверить. А хорошая ли вообще идея – пытаться перевернуть с ног на голову социальные иерархии с помощью какой-нибудь неврологической методики?

Таким образом, иерархии утвердились среди такого большого количества видов животных, потому что в них есть смысл. Они, например, служат предотвращению конфликтов, поскольку не нужно каждый раз заново устраивать поединок, на кону которого будет стоять решение, кто первым сможет подойти к еде. Даже у людей есть разумное соглашение о том, что полицейскому разрешено посадить пьяного водителя транспортного средства в тюрьму, а пьяному полицейского в багажник – нет. Кроме того, высшей позиции в иерархии сопутствуют не одни лишь плюсы. Исследования групп приматов показывают, что не только жизнь низших звеньев социальной структуры сопряжена с большим стрессом, но и верхних. Илон Маск, альфа-самец в сфере основания компаний, считал, что создавать компанию – это все равно что есть стекло и таращиться в пропасть. Так что следует дважды подумать, прежде чем становиться шефом.

Один из 500 человек лишается жизни во время секса.

А что касается преимуществ при поиске партнера, пожалуйста, не забывайте, что один из 500 человек лишается жизни во время секса. Надеюсь, такой цели вы все же себе не ставите. Несомненно, стиль жизни босса имеет свои преимущества. Но нет сомнений также и в том, что за него тоже приходится расплачиваться, и нет никакой гарантии, что вы действительно будете счастливее на вершине социальной иерархии.

 

Стремление к счастью

Ваше стремление к счастью обречено на провал уже потому, что вы понятия не имеете, чего на самом деле хотите. Представьте, что в вашем распоряжении есть все варианты, – как бы вы хотели провести свою жизнь? Сидеть на пляже, куда не ступала нога человека, пока солнце ласкает вашу загорелую кожу, слушать мягкий шелест волн и с наслаждением потягивать пина-коладу? Конечно, это прекрасный способ провести время после обеда, но попробуйте проводить его так на протяжении нескольких месяцев, и вы превратитесь в безработного алкоголика со склеритом, злокачественной меланомой и диабетом 2-го типа.

Почему вы вообще думаете, что было бы хорошо постоянно быть счастливым? Я рад за всех, кому удается медитировать с ощущением непрекращающегося блаженства в стенах какого-нибудь монастыря, но это не кажется мне безумно осмысленным. И если вы пригласите десять таких ультрагармоничных типов на свой день рождения, это будет самая скучная дружеская вечеринка.

А вот то, что вы всегда недовольны, имеет смысл. Система вознаграждений мозга предназначена не для того, чтобы организовать вам крутое времяпрепровождение, а чтобы мотивировать вас делать вещи, которые будут двигать вас вперед.

С точки зрения эволюции, полная удовлетворенность была бы абсолютно контрпродуктивной.

Мы – потомки пещерных людей, которые были недовольны – эволюционный факт, с которым нигде не сталкиваются так часто, как в муниципальных районах Вены. Химия нашего мозга направлена на желание обладать вещами, которых у нас нет. Особую роль в этом играет нейромедиатор дофамин. Он считается одним из классических гормонов счастья. На самом деле его способ действия слишком сложен, чтобы навешивать на него этот примитивный ярлык, но поскольку дофамин действительно ассоциируется с позитивными событиями, удовлетворенностью и чувством счастья, мы оставим его для простоты.

Но даже если дофамин ощущается нами как нечто хорошее, в конечном счете он не является другом удовлетворенности. Представьте, что вы поместили обезьяну в клетку. Затем вы снабжаете животное рычагом, с помощью которого оно может добывать вкусный изюм. Когда обезьяна съедает изюм, ее мозг начинает вырабатывать дофамин, и животное становится довольным. Однако теперь вы меняете ход эксперимента. Прежде чем установить рычаг в клетку, зажгите свет, который сигнализирует обезьяне, что рычаг скоро появится. Через некоторое время световой сигнал у животного будет ассоциироваться с вознаграждением. В результате мозг обезьяны по-прежнему вырабатывает дофамин, когда та съедает изюм, но еще больше дофамина будет вырабатываться при включении света. Гормон счастья выделяется меньше при достижении цели в сравнении с ощущением приближения к цели.

У человека дофамин играет ту же роль. Это нейромедиатор, который заставляет пожилых господ часами спускать деньги на игровые автоматы в казино в надежде на то, что за этим последует награда. Это причина, по которой я каждые десять ярдов, как невротик со слюной в уголке рта, вытаскиваю свой телефон из кармана, чтобы проверить, сколько лайков в Инстаграме набрало мое сэлфи.

Некоторые лекарства нацелены на увеличение содержания дофамина в мозге. Препараты от болезни Паркинсона часто относятся к таким. У некоторых пациентов был обнаружен нетипичный побочный эффект: они стали сексуально озабоченными азартными игроками. Взаимосвязь долгое время оставалась незамеченной, потому что пациенты с болезнью Паркинсона, когда доктор спрашивал их о том, как они переносят это лекарство, редко отвечают: «Хорошо, но я просадил свою пенсию на игру в рулетку и могу синхронно вторить любому видео с Pornhub». Дофамин заставляет нас стремиться делать то, что, согласно нашим ожиданиям, принесет награду или удовлетворение. Это важно для нашей мотивации. Однако, как мы видим из примера с обезьяной и изюмом, механизм действия дофамина также виноват в том обстоятельстве, что достижение цели зачастую дарит меньше удовлетворения, чем мы ожидали.

Гормон счастья больше выделяется при предвкушении события, чем при его достижении. Что делает нас счастливыми?

В исследованиях счастья есть термин «гедонистическая беговая дорожка». Он описывает тенденцию людей сильно переоценивать влияние жизненных событий на ощущение счастья. Стремление к счастью сравнивается с неким колесом, в котором приходится безостановочно трудиться, но оно всегда остается на месте. Это было впечатляюще продемонстрировано в исследовании 1978 года, когда среди победителей лотереи, парализованных людей и контрольной группы проверялось, сколько радости они испытывают в своей повседневной деятельности и каковы их прошлые и будущие ожидания счастья. В результате выяснилось, что победители лотереи в среднем не счастливее людей, которые не выигрывали в лотерею. Кроме того, победители лотереи оказались лишь немного счастливее людей, которые были парализованы в результате несчастного случая.

Насколько отличается уровень счастья людей, на 50 % объясняется их генами. Общие условия жизни объясняют около 10 %, и на 40 % влияют ежедневно принимаемые решения. Эта формула 50/10/40, которая возвращает нас к исследованиям близнецов, стала довольно популярной в области исследований счастья и считается устоявшимся практическим правилом того, как у людей возникает это ощущение. На самом деле все, конечно, сложнее, потому что гены взаимодействуют с окружающей средой, и ощущение счастья меняется в течение жизни. Но это не меняет того факта, что наши решения могут повлиять только на определенный процент испытываемого нами счастья.

Недавнее исследование показало, что величайшим источником счастья являются моменты с участием других людей. Поэтому было бы крайне неразумно делать вещи, которые ведут к социальной изоляции, например писать книгу. К счастью, мой основной интерес как молекулярного биолога – не скучные 40 %, а генетически обусловленные 50 %. Однако поиск генетической основы удовлетворенности жизнью все еще находится в зачаточном состоянии. Полногеномное исследование ассоциаций, в котором приняли участие 300 000 человек, смогло идентифицировать только три области генома, связанные с переживанием ощущения благополучия. В целом, это может объяснить только 0,9 % различий между людьми. Пройдет некоторое время, прежде чем мы сможем инфицировать наш мозг генно-инженерными вирусами счастья, которые приведут к нескончаемому блаженству.

Ну а пока вкладывайте свои деньги в другие вещи. Конечно, вы знаете поговорку, что «счастье не в деньгах». Но в Ferrari плакать определенно приятнее. Исследования показывают, что деньги могут сделать счастливым. Но все же решающим фактором остается то, на что они тратятся. Удовлетворенность действительно может возрасти, если вы тратите деньги не на какие-то предметы роскоши, а на события. Желательно те, которыми можно наслаждаться с другими людьми, например посещение кинотеатра или охота с луком в сибирской горной тундре. Будет еще лучше, если эти события планировать заранее, потому что, как мы убедились на примере обезьяны с изюмом, ожидание часто приносит больше радости, чем сама награда. Поэтому, если вы хотите что-то купить, психологи рекомендуют отложить это до особого случая, чтобы за время ожидания получить возможность в качестве бонуса набрать максимально большое количество очков удовольствия.

Ощущение счастья человека на 50 % определяется его генами.

Кроме того, в недавно опубликованной работе было продемонстрировано, что удовлетворение можно получить, вкладывая деньги в вещи, которые экономят время. Например, если за вас кто-то косит газон, убирает квартиру или совершает покупки. Купленное время улучшало настроение участников исследования и уменьшало уровень тревожности. Эффект не зависел от дохода или количества часов, которые испытуемые проводили за работой.

 

Осмысление счастья

Парадокс счастья заключается в том, что каждый мечтает увеличить его, но, возможно, лучше не пытаться. Наука собрала много доказательств того, что сознательное стремление к счастью делает людей определенно менее довольными. Те, кто судорожно за ним бежит, часто оказываются в спирали неудач: поскольку все усилия еще не привели к состоянию длительного блаженства, люди считают нужным работать еще усерднее.

У людей, которые непременно хотят быть счастливее, часто возникает чувство, что им не хватает времени, чтобы выполнить все необходимые действия, которые приблизили бы их к цели. Кроме того, желание стать более счастливым часто заставляет фокусироваться на восприятии негатива, а именно на всех тех вещах, что делают несчастными.

Может быть, вы должны просто принять свое внутреннее недовольство и стремиться не к счастью, а к чему-то более ценному. В конечном счете погоня за личным счастьем – это поверхностное, почти эгоцентричное устремление. Взять, к примеру, решение завести детей, которое позволяет немного повысить удовлетворенность женщин жизнью. Но только до тех пор, пока дети не появляются на свет. Уровень удовлетворенности тогда внезапно начинает стремительно падать и с годами колеблется все сильнее, возвращаясь к исходному уровню. Означает ли это, что, будучи рациональным существом, человек должен отказаться от потомков? Или это означает лишь то, что в жизни есть более важные цели, чем максимизация собственного счастья?

Хорошим кандидатом на позицию лучшей цели была бы попытка прожить жизнь, которая ощутимо имела бы смысл. Это, хоть и необязательно, но все же может сопровождаться тем, насколько человек счастлив. Не каждый лауреат Нобелевской премии мира будет маршировать по всему миру с широкой улыбкой, но многие из них, вероятно, чувствовали, что они положили начало чему-то значимому в своей жизни. Правда, стремление жить осмысленной жизнью также имеет корыстные мотивы.

Исследования показали, что ощущение осмысленности жизни сопряжено с пониженным риском инсульта, болезни Альцгеймера и различных нарушений в организме. Оно также приводит к улучшению качества сна и к снижению смертности в целом.

Против стремления к счастью стремление к смыслу имеет большое преимущество, заключающееся в том, что он, смысл, касается не только отдельно взятого человека: ему сопутствуют совершение добрых поступков и забота о других. Канадский психолог Джордан Петерсон сформулировал это так: «Если ты пытаешься быть хорошим, ты, наверное, и есть хороший, а иногда еще и счастливый. Если ты пытаешься быть счастливым, ты, вероятно, нехороший и счастлив лишь изредка».

 

Что же будет дальше?


«Что делает эта кнопка?»

«Так будет лучше для нас обоих».

«Интересно, где мама медвежат».

Классические последние слова. Не многие так безобидны, как эти. Например, вот фраза американского серийного убийцы Карла Панцрама в то время, когда его палач готовил виселицу: «Давай быстрее, ублюдок ты деревенский! Я мог бы убить десять человек, пока ты там возишься!» Некоторые люди настолько переполнены ненавистью и гневом, что едва ли могут себе представить обычных людей на чилле. Если только они время от времени не читают комментарии к видео на YouTube – вот где официальное дно Интернета. Я подумываю о том, чтобы закончить эту книгу тремя страницами отборнейших ругательств и сравнений с Гитлером, чтобы установить контакт молодого поколения социальных сетей с этим старым носителем. Но, может быть, все не так уж плохо, как кажется.

Очень маленькое, но чрезвычайно активное меньшинство должно нести ответственность за тот факт, что Интернет стал таким отвратительным местом, где уже даже невозможно выложить смешное видео с котиками, не ожидая при этом оскорблений радикальных владельцев полевых мышей.

B результате анализа комментариев на Facebook на немецком языке выяснилось, что половина всех лайков на хейтерских комментариях исходит только от 5% аккаунтов. При этом 25% хейтерских лайков ведут всего лишь к 1 % профилей.

Но даже если не брать в расчет несчастных интернет-хулиганов, злобность не распределяется по населению равномерно. Одно исследование, в котором приняли участие более двух миллионов шведов, показало, что только 1% населения несет ответственность за 63% всех преступлений, совершенных с применением насилия. Так что хорошая новость в том, что большинство людей все равно славные ребята. Плохо то, что небольшой группы крайне безжалостных людей достаточно, чтобы нанести огромный социальный ущерб.

«Они мучают и уродуют своих жертв с таким же рвением, какое наш брат испытывает, потроша рождественского гуся», – вот как описал канадский психолог-криминалист Роберт Д. Хаэр хладнокровие, которое испытывают психопаты, пытая своих жертв. Психопатия – это крайняя форма антисоциального расстройства личности, которое может быть связано с полным отсутствием эмпатии, социальной ответственности и совести. Это относится примерно к 1% населения и, согласно исследованиям близнецов, в значительной степени зависит от генетики. Какие бы усилия ни прикладывались, свести к нулю число людей, которые преследуют цели киношных злодеев, не удается. Представьте, что существовала бы кнопка, которая может целиком взорвать Австралию. Сколько понадобится людей, получивших возможность анонимно нажать на нее, прежде чем один все-таки решит это сделать? Просто потому, что это так легко и захватывающе. Возможно, среди миллиона человек не найдется ни одного, который был бы готов сделать это. Но возможно и то, что на каждой второй станции метро сидит тот, кто, прежде чем сотворить такое, плюнул бы себе на ладони, да еще и замахнулся.

Может быть, этот мир все еще стоит, как и прежде, только потому, что такая кнопка еще не изобретена. Конечно, есть ядерное оружие, но его редко используют только потому, что у кого-то выдалась плохая неделя. После того как шведа Ричарда Хандла вышвырнули с работы, он начал мастерить на своей кухне ядерный реактор. Для этого он использовал радий из стрелок старых часов, америций из детекторов дыма, торий из газовых фонарей и уран, который он заказал в одной американской компании. Хандл был задержан только тогда, когда связался с Управлением по вопросам радиационной безопасности, чтобы спросить, является ли все это законным. К счастью, чтобы нанести большой вред при помощи расщепления атомов, недостаточно просто собрать небольшую группу фанатиков. Но что, если мы станем настолько технологически продвинутыми, что десять полукомпетентных психов, используя самые простые средства, смогут нанести такой же или больший урон, чем самое мощное оружие современности?

 

Опасная биология

На искоренение оспы, одной из самых смертельно опасных вирусных болезней в истории человечества, ушли десятилетия и миллиарды долларов. Уже более 40 лет назад чума исчезла из этого мира. Однако, чтобы вернуть ее, достаточно было бы небольшой команды, обладающей определенными профессиональными знаниями, 100 000 долларов на материалы и полугода. В начале 2018 года была опубликована работа, в которой канадская исследовательская группа производила вирусы лошадиной оспы, заказывая и получая по почте необходимые последовательности генов у одной немецкой компании через Интернет. Эти фрагменты ДНК они упаковывали в клетки, которые уже были заражены другим вирусом, а затем начинали производить вирусы лошадиной оспы. Для людей лошадиная оспа не представляет опасности, но ученые не скрывают, что эту же простую технологию можно использовать для создания вирусов оспы, которые в прошлом унесли жизни сотни миллионов человек. Однако созданный таким образом вирус можно сделать еще более опасным, чем его естественный образец. Еще в 2001 году австралийские исследователи создали измененный вирус мышиной оспы, который легко уничтожил всех инфицированных животных. Кроме того, они также представили ген, который инициирует производство большого количества интерлейкина-4, нейромедиатора, подавляющего часть иммунной системы, борющейся с вирусами. Можно предположить, что добавление гена интерлейкина-4 также может значительно увеличить количество смертей от вирусов человеческой оспы.

Разве это не будет отличной идеей проекта для молодых, прогрессивных биотеррористов? Или это для них слишком сложно? И если вещи, которые начинаются с «био», согласно рекламе, всегда хорошие, а террористы всегда плохие, означает ли это, что биотеррористы – ни то ни се? Вирусолог Андреас Нитче из Центра исследования вопросов биологической опасности при Институте Роберта Коха в Берлине считает, что для производства подобного рода вирусов достаточно иметь степень магистра биологии. В разговоре о террористах нам в голову редко приходят академики. Правда, даже сам Усама бен Ладен получил высшее образование, возможно, надеясь, что в университете найдется парочка негодяев, которые придут в восторг от идеи создания прекрасного мира синтезированных вирусов.

Многие видят серьезную проблему в том, что новые технологии позволяют все меньшим группам людей наносить все больший и больший ущерб. Одним из числа обеспокоенных этим вопросом является философ Джулиан Савулеску, профессор, преподающий прикладную этику в колледже Святого Креста в Оксфорде. Он подчеркивает, что для создания катастрофы достаточно лишь одного безумца, готового сделать суперсмертельный вирус. И в ближайшее время десятки тысяч людей будут иметь возможность сделать это. В этом Савулеску видит проблему, не в последнюю очередь из-за нашего эволюционного наследия. Он аргументирует это тем, что человек развивался в среде, которая настолько сильно отличается от сегодняшней, что интуитивное чувство этичного может сгубить нас. В течение длиннейшего периода эволюционного развития люди жили небольшими группами, в которые входили несколько десятков человек. Благодаря этому в нашей биологии закрепились этические убеждения, способствующие сплоченности в собственной группе, но заставляющие питать недоверие к чужакам, с которыми часто приходилось раньше сражаться за ресурсы.

Это чувство осталось с нами по сей день и проявляется, например, в механизме действия «связывающего гормона» окситоцина. Он называется связывающим, потому что иногда выделяется у мамочек, когда они слышат, как их ребенок плачет или кормят грудью. Таким образом, окситоцин усиливает эмоциональную связь между матерью и ребенком. Нежности, ласка или приятный половой акт также заставляют гормон выделяться, тем самым способствуя развитию любви и доверия.

Но в то время как окситоцин способствует укреплению связи с близкими вам людьми, другим людям приходится не так-то просто.

Исследования показали, что, хотя окситоцин и воздействует положительно на готовность к совместным действиям и уровень доверия в собственной группе, он способствует также и сохранению защитной позиции по отношению к посторонним.

Исследователи называют этот эффект реакцией «Tend and Defend»: «Оберегай и обороняй».

В доисторические времена, отличительной чертой которых были частые конфликты между небольшими группами, такие механизмы, вероятно, имели право на существование. Однако, с точки зрения современного глобализированного мира, их можно рассматривать как эволюционный балласт, который усложняет мирное сосуществование и мешает нам решать самые большие проблемы современности.

В конце концов, предрассудки, терроризм, этнические чистки и войны порой происходят из-за того, что люди считают собственную группу лучшей и самой важной в мире, в то время как посторонние воспринимаются как зло во плоти. Если в нашей биологии все еще сохраняются факторы, поддерживающие такую позицию, она может оказаться в весьма плачевном состоянии из-за легкости в создании биологического супероружия. Потому Савулеску объясняет, что, возможно, нам давно следовало избавиться от этого эволюционного балласта, чтобы человечество сохранило свой род надолго. Поэтому он затрагивает вопрос этической оптимизации человека – при помощи лекарственных средств или генетики.

 

Этическая оптимизация

Идея не новая. Во время Второй мировой войны союзники размышляли о том, чтобы дать агентам поручение: подмешивать в еду Гитлера женские половые гормоны. План состоял в том, чтобы сделать его более женственным, менее агрессивным товарищем. Его вряд ли можно было отравить напрямую, потому что его дегустаторы предотвратили бы это. Но идея подкрадывающейся феминизации, которая, возможно, заставила бы его пересмотреть некоторые вопросы касательно геноцида, была в пределах досягаемости. Почему планы не были реализованы – неизвестно. Может, они боялись, что леди-Адольф раз в месяц будет устраивать блицкриг.

В любом случае эпоха подъема морального духа химии была далека от завершения. Многие из часто назначаемых лекарств влияют на основы наших этических чувств, хотя лишь изредка упоминаются в этой связи. Например, популярный антидепрессант флуоксетин, известный в США под названием «Прозак», увеличивает количество серотонина в мозге. Он делает принимающих его не только менее агрессивными, но и повышает готовность к кооперации. Препарат пропранолол, который часто назначают при гипертонии, также может влиять на этичность наших действий. Одно исследование показало, что пропранолол понижает не только давление в артериях, но и бессознательную неприязнь к людям иностранного происхождения. Его можно было подмешивать в мюсли Гитлера вместо женских гормонов. Однако он был разработан слишком поздно, и, кроме того, было бы гораздо веселее наблюдать за тем, как растет грудь фюрера.

Риталин, который так ценится пациентами с СДВГ и студентами-медиками, не только повышает внимание: есть подозрение, что он понижает уровень агрессивности. Рассматривать ли эти эффекты как этическую оптимизацию или как побочный эффект, каждый решает сам. В любом случае ясно, что благодаря широкому использованию этих веществ мы уже сегодня при помощи химии в большой степени влияем на моральные решения людей.

Во время Второй мировой войны союзники подумывали подмешивать в еду Гитлера женские половые гормоны.

 

Стать более эмпатичными

Что же все-таки делает хорошего человека хорошим? И должны ли мы в любой ситуации стремиться к единству? Если бы мы жили без грехов, Иисус совершенно напрасно позволил прибить себя к кресту. Тем не менее большинство старается. Говорят, что хорошие люди особенно эмпатичны, то есть обладают выраженной способностью проникаться чувствами других и испытывать сострадание. Эмпатию часто называют предпосылкой к готовности помочь и порядочности. Кроется ли в этой черте характера ключ к гармонии, миру во всем мире и всему остальному бреду в стиле шайки хиппи? Может, даже когда-нибудь генетическое усиление эмпатии позволит нам разрешать конфликты более справедливо и мирно, чем мы делаем это сегодня?

Исследования показали, что различия в чувстве эмпатии между людьми примерно на 20–70 % могут быть объяснены генетикой. Диапазон настолько большой, потому что наследственная часть чувства эмпатии, как и в случае с интеллектом, с годами меняется. В последнее время обнаруживается все больше и больше ответственных за это областей генов. Тем не менее исследования также получили новые, неожиданные результаты.

Некоторые области генов, которые усиливают эмпатию, также увеличивают риск шизофрении и анорексии.

Но это еще не все скрытые стороны эмпатии. Она гораздо больше, чем чувство «люблю вас всех», которым часто прикидывается.

Эмпатия может сподвигнуть нас к действиям, которые, хотя и ощущаются как хорошие, на самом деле контрпродуктивны, когда речь идет о минимизации страданий. Психолог Пол Блум приводит в качестве примера, что демонстрация единственной жертвы насилия трогает нас гораздо больше, чем все печальные новости об изменении климата вместе взятые – и это при том, что последнее связано со значительно большим числом жертв, и проблемы, лежащие в основе изменения климата, должны быть решены как можно быстрее. Тем не менее эмпатия почти слепа к таким крупным катастрофическим событиям. Одна единственная трагическая судьба вызывает в нас гораздо большую потребность в действиях, чем судьбы тысяч или даже миллионов людей. Для улучшения общей ситуации это может стать помехой.

Кроме того, эмпатия заставляет нас принимать сторону андердогов. Такое, может, и делается с хорошими намерениями, но не всегда оказывается лучшим решением. Можете думать о Дональде Трампе все что вам угодно, но выступать в роли одинокого борца с гигантским политическим истеблишментом на президентских выборах 2016 года в США было далеко не глупой стратегией. Чем больше на него нападали, тем больше симпатии это вызывало у его избирателей. Исследователь в области когнитивной психологии Фриц Брейтгаупт утверждает, что эмпатия может сыграть большую роль даже в тех случаях, когда помогает людям активно ухудшать положение других. В качестве примера он упоминает больных людей или людей с ограниченными возможностями, которых буквально выставляют жертвами, чтобы те, кто им сочувствует, могли радоваться своей благодетельности. То, что цементирует затруднительное положение других, дарит нам возможность чувствовать свое моральное благородство. Часто чувства сострадания достаточно, чтобы мы твердо уверились в себе как в хорошем человеке. При этом можно проникнуться к человеку таким сильным состраданием, что ему оно даже будет во вред. Классическим примером этого являются чрезмерно заботливые родители, которые так отчаянно пытаются защитить своих детей от всевозможного зла, что в итоге те превращаются в абсолютно несамостоятельных неженок. Сама по себе эмпатия – не добродетель!

Это чувство может заходить настолько далеко, что садисты наслаждаются страданиями своих жертв именно потому, что получают возможность упиваться своим сочувствием к ним сполна. Эмпатия, несомненно, может способствовать активации действий, движимых моралью, но идея о том, что большее сострадание неизбежно сделает мир лучше, слишком упрощенная. Кроме того, эмпатия – не единственный пример того, что обладает хорошим имиджем, но при ближайшем рассмотрении может сыграть с нашим поведением злую шутку. В этой категории может оказаться даже великолепная летняя погода. Криминальный накал

Поэтому изменение климата так здорово получается игнорировать – ведь сокрушения какого-нибудь фермера по поводу гибели урожая из-за засухи никогда не будут настолько же плохи, насколько хороша потрясная температура для купания на озере Нойзидлер-Зе. Однако сполна насладиться купанием мешает раздражение оттого, что другие автомобилисты на пути к озеру постоянно сигналят, и впоследствии становятся жертвами убийства. Это происходит быстрее, чем кажется, особенно когда очень жарко. Ведь когда температура на термометре поднимается, падает необходимость вести себя как порядочный человек. Поэтому часто игнорируемым побочным эффектом изменения климата может быть еще и общее повышение уровня агрессии и насилия. Ранее доказательства тому открылись благодаря классическому эксперименту, проведенному в 1980-х годах. Вам, вероятно, знакома виртуозная какофония автомобильных сигналов, когда светофор переключается на зеленый, а вы не нажимаете педаль газа в течение 0,3 фемтосекунды. В ходе исследования ученые предложили женщине немного задержаться при зеленом светофоре и проанализировали поведение других водителей. В жаркие дни ей сигналили особенно долго, причем чаще всего в машинах без кондиционеров. Это кажется понятным, потому что хочется побыстрее убраться с жары, а люди в стоящих машинах так или иначе раздражены.

В жаркое лето преступления с применением насильственных действий происходят чаще, чем в прохладное.

Но за пределами своих транспортных средств многие заходят еще дальше. Если дать людям возможность истязать других электрошокером, под влиянием жары они предпочтут делать это как можно более долго. В другом эксперименте исследователи проверили, как голландские полицейские реагировали на стрессовую ситуацию во время учебных стрельб. В симуляции им угрожал разъяренный человек с ломом, и они должны были решить, выстрелить в него или разрешить ситуацию иначе. В этом случае решающее значение имела комнатная температура. При комфортных 21°C полицейские прибегали к использованию оружия в 45% случаев. Однако при неприятных 27°C этот показатель равнялся целым 60%. Если вдруг вы нарушили закон, по крайней мере, включите кондиционер, когда полиция начнет штурмовать ваш дом.

Авторы исследования объясняют это тем, что высокие температуры в целом вызывают негативные ощущения, и люди реагируют на это поиском вероятной причины. Другими словами, люди чувствуют себя дерьмово и хотят переложить вину за это на кого-нибудь. Это также может быть причиной того, что в жаркое лето преступления с применением насильственных действий происходят чаще, чем в прохладное. Кажется, что между числом убийств и высокими температурами существует связь, которая сохраняется, даже если статистически вычисляются другие факторы негативного воздействия. Поэтому исследователи предполагают, что изменение климата может способствовать будущим насильственным преступлениям. Психолог Крейг Андерсон предрекает: в США при повышении средней годовой температуры на 1°C будет почти на 22 000 убийств в год больше. Вывод: глобальное потепление еще более проблематично, чем многие думают, и, если закрыть на это глаза, кондиционеры могут сойти за этическую оптимизацию.

 

Ешьте на здоровье

На наш этический выбор могут повлиять даже гораздо более простые вещи, чем кондиционер, – например, стратегически умно припасенный бутерброд. Американские исследователи в 2010 году проанализировали более тысячи слушаний преступников, добивающихся испытательного срока при условном осуждении. При этом рабочие дни судей были разделены на три заседания, которые прерывались двумя перерывами на обед. Выходили ли преступники на свободу с испытательным сроком, зависело не от их национальности или пола, а в первую очередь от содержимого желудка судей. В начале слушания шанс на испытательный срок был около 65 %. Однако в конце заседания вероятность освобождения сводилась почти к нулю. Но как только судьи возвращались с перекуса, шансы на получение испытательного срока снова возвращались на исходный уровень. Удивительно отчетливо выраженный эффект, который неоднократно подтверждался во время многочисленных слушаний в течение многих месяцев. Авторы исследования считают, что причина вот в чем.

Уставшие, голодные люди с большей вероятностью принимают более простые, стандартные решения.

Освобождение преступника на испытательный срок рискованно и требует интенсивного рассмотрения, которым истощенный мозг неохотно обременяет себя. Насколько этот эффект можно объяснить перерывом или едой, неизвестно. Однако авторы исходят из того, что серьезное влияние оказывает повышающийся после еды уровень глюкозы. Заключение этой работы: даже неприправленный кебаб может повлиять на сложные этические решения.

Исследователи предполагают, что подобный эффект можно наблюдать и в других областях, где люди должны принимать сложные, последовательные решения, такие как визиты к врачу или ученые советы, принимающие решение о финансировании исследований. Лично я не удивлюсь, если можно будет избежать половины ссор, связанных с отношениями, обеспечив два наполненных желудка, прежде чем приступать к обсуждению сложного вопроса. Если вы хотите поговорить с вашим партнером на тему «Мы слишком часто бываем у твоей мамы», то в качестве превентивной меры накормите его до отвала пиццей. Либо это усмирит его нрав, либо он будет настолько объевшимся, что не сможет побежать за вами. Бездумный надзор и мир во всем мире

Вы определенно знаете внутренний конфликт подростка-христианина, который пытается спокойно помастурбировать, но не может насладиться этим и вполовину, потому что распятый Иисус, висящий над его кроватью, так страдальчески смотрит сверху вниз. Воскресение в штанах заканчивается, так толком и не начавшись.

Когда кто-то смотрит на нас, мы часто ведем себя более честно и социально приемлемо, чем когда мы не чувствуем на себе чей-то взгляд. При этом совершенно необязательно, чтобы за нами действительно наблюдали.

Изменения в поведении могут произойти, даже если к стене просто приклеить картинку с парой глаз. Это называется эффект Watching-Eyes, эффект смотрящих глаз, и между тем, уже опубликованы многочисленные исследования, в которых описываются его проявления. Например, приклеенные к стене глаза заставляют студентов оставлять меньше мусора в столовой. Даже число краж велосипедов в университетском кампусе было значительно уменьшено при помощи приклееных больших мужских глаз, а в супермаркете деньги чаще бросали в те ящики для пожертвований, на которых были изображения глаз. Окружающая среда тоже выигрывает от того, что приклеенные глаза смотрят в самую глубь наших душ. Удачно размещенные глаза заставляют более сознательно подходить к утилизации отходов, и люди выбрасывают на улицу меньше мусора. Исследователи предполагают, что этот эффект может быть полезен для борьбы с антиобщественным поведением и даже преступностью в реальном мире. Я скептически отношусь к такому заявлению, потому что это может стать привычным, и большинство исследований проводилось в то время, когда люди все еще время от времени поднимали глаза от экранов своих мобильных телефонов. Кроме того, многие исследования, изучающие воздействие приклееных глаз, довольно небольшие, их еще не воспроизводили, и к тому же они отчасти противоречивы. Соответственно, пройдет еще какое-то время, прежде чем мы сможем достоверно оценить вклад, который приклеенные глаза могут сделать для спасения мира.

Интеграция всех этих советов в повседневную жизнь – задача не из легких. Возможно, вы все равно установили бы кондиционер, даже не испытывая страха быть застреленным полицией. Если перед каждым этическим выбором вы набиваете живот, ощущение собственного морального благородства может быть омрачено избыточным весом. И вы действительно хотите, чтобы на вас в туалете пялились со стены гигантские глаза, просто чтобы заставить вас использовать туалетный ёршик? Или для спасения мира все это вообще не нужно? Апокалипсис может подождать

Почему кто-то вообще пишет книгу об оптимизации человека? Но это же очевидно – из-за отчаянного разочарования, связанного с тем, что мир и его обитатели настолько стремительно катятся вниз, что героические генетики должны спешить на помощь. Или не должны?

Моя культурная идентичность жителя Вены противится проявлению оптимизма касательно какой угодно темы. Поэтому я делегирую миссию по растапливанию этого льда кому-то, кто способен сделать это без необходимости отречься от своих корней: «Если бы вы могли выбрать родиться в какой-то момент истории человечества, не зная заранее, какими будут ваши национальность, пол или экономический статус, вы бы выбрали сегодняшний день… Нам повезло жить в самую процветающую и продвинутую эру человеческой истории. Последняя война между великими державами произошла десятилетия назад. Все больше и больше людей живут при режиме демократии. Мы стали более обеспеченными, здоровыми и образованными, у нас есть мировая экономика, которая избавила более миллиарда человек от нищеты», – Барак Обама, 2016 год. Конечно, мир выглядит намного радужнее, если вы самый могущественный человек, живущий в нем. Тем не менее он прав. Стивен Пинкер выразил это следующим образом: «Газеты могут каждый день вставлять такой заголовок: “Количество людей, живущих в условиях крайней нищеты, вчера снова сократилось на 137 000” – и так каждый день в течение 25 лет».

Многое в мире идет удивительно хорошо. Но лишь изредка люди получают что-то от этого. Одной из причин является так называемая эвристика доступности. Это своего рода практическое правило, которое наш мозг использует для классификации неполной информации. При этом сложный вопрос фактической частоты события заменяется более простым вопросом о том, насколько легко нам вспомнить соответствующие примеры.

Наш мозг путает легко восстанавливаемое с правдивым. Поэтому легко запоминающиеся изображения нападений акул оказывают чрезмерно большое влияние на наше чувство безопасности – и это несмотря на то что больше людей погибают из-за свалившихся автоматов с напитками или неудачных попыток сделать сэлфи.

«Снова ни одной атаки акул на Ибице» – опять же малопривлекательная история для журналистов. Специалист по обработке данных Калев Литару проанализировал содержание новостных порталов по всему миру с 1979-го по 2010 год. При этом он оценивал, насколько часто использовались позитивные термины и насколько часто негативные. Проявилась почти линейная тенденция к увеличению негативного освещения событий.

Но почему так? Действительно ли мир становится все более угнетающим местом? Или новостные порталы просто поняли, что больше денег можно заработать с «топом худших», а не с «топом лучших»?

Наверняка вы тоже будете регулярно сталкиваться с темой «вырубка тропических лесов». Это, конечно, оправданно, но было бы в равной степени интересно узнать о том, что лес великолепно процветает за пределами тропиков. И настолько великолепно, что в период с 1982-го по 2016 год мир обрел в общей сложности около 7 % лесных массивов, как показывают исследования природы от 2018 года. По сравнению с изображениями голых площадей уничтоженных лесов такие новости не особо впечатляют. Маркетинговые исследования показали, что никакой другой контент в Интернете не имеет больше шансов стать вирусным, чем тот, который злит и вызывает особенно сильные эмоции. При этом ощущение, что мир находится на грани гибели, не покидает до тех пор, пока человек не выключит компьютер и, выйдя за дверь, не будет шокирован, обнаружив, что на самом деле здесь довольно славно.

Не поймите меня неправильно, мир полон ужасных трагедий и проблем, которые нужно срочно решать. Но многие вещи из тех, что мы справедливо считаем катастрофами, с сегодняшней точки зрения являются трагическими отголосками прошлого, в котором они были в порядке вещей. Генетический анализ показывает, что межродовые войны были настолько популярны в эпоху нового каменного века, что во многих регионах Европы, Азии и Африки временами на 17 женщин приходился только один мужчина. Звучит, как будто намечается вечеринка, но, конечно, это было не так здорово, как многие думают. Антрополог Роберт Келли провел исследование 15 народностей охотников и собирателей. В 11 из них частота убийств была выше, чем в самой жестокой нации из всех современных.

Одну из самых интересных лекций, которые я когда-либо слышал, читал антрополог, который рассказывал о своей исследовательской поездке к относительно нетронутому цивилизацией народу охотников и собирателей на юге Таиланда. Небольшая деревенская община питалась тем, что давал им лес, мужчины и женщины были в значительной степени равны, и периодическая смена половых партнеров также способствовала формированию образа чрезвычайно гибкого естественного народа, значительно превосходящего наше современное общество, погрязшее в жестокой конкуренции. После лекции я спросил его, как же все-таки эти люди поступают со всеми детьми-инвалидами, которые неизбежно появляются при таком скудном генетическом разнообразии? Он сказал, что точно не знает, ему известно лишь то, что жители деревни идут с ними в лес и возвращаются без них.

Многое из того, что в течение долгого времени нашего развития считалось само собой разумеющимся, сегодня считается немыслимым. Когда в последний раз вы бросали свою пожилую родню только потому, что ресурсы были на исходе? Где сегодня все еще в порядке вещей в целях предосторожности убивать незнакомцев, которые неожиданно появляются на пути? Даже в венском районе Фаворитен такого нет. Несмотря на все проблемы, с которыми мы сталкиваемся сегодня, многие области нашей жизни развиваются в более этическом направлении. Несмотря на то что важно обращать взгляд туда, где не все идет гладко, все же стоит держать в голове и развитие в долгосрочной перспективе, чтобы избежать искажения представлений.

Однако вам не нужно возвращаться к доисторическим временам, чтобы увидеть события, развивающиеся позитивно. В своей книге «Просвещение сегодня» Стивен Пинкер описывает многие явления, которые в течение многих лет постоянно развивались на глобальном уровне в настолько положительном ключе, что о них почти никогда не было слышно.

«Вещи, которые идут на спад во всем мире: смерти на войне, голодные смерти, крайняя нищета, недоедание, геноцид, детский труд, детская смертность, количество ядерного оружия. Вещи, которые растут во всем мире: продолжительность жизни, демократизация, грамотность, права гомосексуалистов, признание прав человека. Я не думаю, что для спасения мира требуется этическая оптимизация человека. Мы совсем не так плохи, какими себя ощущаем».

 

Заключение

Эволюция сделала нас симпатичными, но странными организмами, биология которых, кажется, иногда имеет мало смысла. Опухоль размером с кулак часто может разрастаться в брюшной полости, оставаясь при этом незамеченной, в то время как крошечная дырочка в зубе вызывает на глазах слезы от боли. Однажды у нас будет возможность изменить это и многие другие наши свойства, если захотим. Технически мы скоро должны быть к этому готовы. Это одна из причин того, почему я убежден, что мы живем в одно из самых захватывающих времен. Мы подошли к моменту, когда фундаментальные изменения нашей биологической основы впервые в пределах досягаемости. И будет нелегко перемещаться по минному полю новых возможностей с должной внимательностью. Конечно, найдется множество отцов, которые в самые мрачные и, возможно, самые искренние моменты своей жизни мечтают о том, что по их стопам будет следовать генетически оптимизированный сверхсын ростом два метра с телом греческого бога и с мужским достоинством таким огромным, что он с трудом сможет пройти через кесарево сечение (и все же немного меньшим его собственного – в противном случае это очень плохо скажется на динамике отношений отца и сына).

Всегда будет присутствовать искушение генетически улучшить себя или других – из-за эгоцентризма, мании величия или человеколюбия. Потому что биология – хаотичный бардак, и с большинством из нас он сыграл веселую шутку, от которой мы хотим сберечь себя и других. Я знаю, о чем говорю. Когда я появился на свет, одна из частей моего тела в своем развитии была примерно на 10 лет впереди других – нос. Только после пубертатного периода остальная часть головы стала соразмерной масштабам органа обоняния. Поэтому в школьные годы я заслужил прозвище The Shark – акула. Все из-за того, что на уроках плавания пара человек всегда выкрикивала: «Осторожно, акула!», когда я плыл на спине и мой носяра торчал из воды. А про непосильную финансовую задачку, сколько на мой нос нужно мази от насморка, я даже говорить не хочу. И как ни трудно поверить, некоторых людей генная рулетка выбрасывает в жизнь с еще более плохими картами.

Будучи генетиком, человек быстро привыкает слушать то, как люди говорят о ДНК, будто это самая обычная вещь в мире. Метильная группа здесь вызывает то, ацетильная группа там вызывает это. Ничего особенного – повседневная жизнь молекулярного биолога, и все же иногда я делаю шаг назад и думаю: никто никогда напрямую не видел, как на самом деле выглядит двойная спираль ДНК.

Никто никогда собственными глазами не видел буквенный код, который является основой нашего существования. Тем не менее мы изменяем его и говорим об этом, как будто это что-то абсолютно достижимое.

Мы можем скопировать некоторые из этих букв из одного организма и поместить их в другой для передачи каких-нибудь черт. Мы можем создать беспрецедентные свойства, умело сложив несколько из этих букв и поместив их в живое существо. Насколько маловероятно, что мы родились после миллиардов лет эволюции в тот самый момент, когда все это внезапно стало возможным? Насколько большую ответственность мы несем? И сколько гениев ночи напролет в течение столетий должны были работать, чтобы сделать все это возможным? Движимые своим любопытством и убеждением, что наука – это нечто ценное и прекрасное.

Мартин Модер, австрийский ученый-генетик

Яндекс.Метрика Top.Mail.Ru